Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 7 showing 121 ~ 140 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

The record is no longer available at this source.

Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Notes: (null) This is a legacy resource.

Proper citation: RRID:WB-STRAIN:ZZY0041 Copy   


The record is no longer available at this source.

Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Notes: (null) This is a legacy resource.

Proper citation: RRID:WB-STRAIN:TRG_1481 Copy   


The record is no longer available at this source.

Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Notes: (null) This is a legacy resource.

Proper citation: RRID:WB-STRAIN:TRG_1482 Copy   


The record is no longer available at this source.

Source Database: WB, WormBase (WB)
Genetic Background: (null)
Affected Genes:
Genomic Alteration:
Availability: Not Available
References:
Synonyms:
Notes: (null) This is a legacy resource.

Proper citation: RRID:WB-STRAIN:WN046 Copy   


  • RRID:WB-STRAIN:WBStrain00031002

http://www.wormbase.org/db/get?name=WBStrain00031002

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: syIs337 syIs398 III.
Notes: Made_by: Han Wang and Jonathan Liu|"syIs337 [15xUAS::pes-10::GFP::let-858 3'UTR + ttx-3p::RFP + 1kb DNA ladder(NEB)]. syIs398 [hsp16.41p::NLS::GAL4SK::VP64::let-858 3'UTR + unc-122p::RFP + 1kb DNA ladder(NEB)]. syIs337 is a GFP cGAL effector. syIs398 is hsp-16.41 cGAL driver for heat shock promoter. Bright GFP fluorescence in a few head neurons without heat shock. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031002 Copy   


  • RRID:WB-STRAIN:WBStrain00031089

http://www.wormbase.org/db/get?name=WBStrain00031089

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: nurf-1(kah91)II/ oxTi924 II
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031089 Copy   


  • RRID:WB-STRAIN:WBStrain00031086

http://www.wormbase.org/db/get?name=WBStrain00031086

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: dpy-10 (kah83)II kyIR1(V, CB4856>N2) qgIR1(X, CB4856>N2).
Notes: Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997

Proper citation: RRID:WB-STRAIN:WBStrain00031086 Copy   


  • RRID:WB-STRAIN:WBStrain00031085

http://www.wormbase.org/db/get?name=WBStrain00031085

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: dpy-10 (kah82)II.
Notes: Information on this strain can be found in the following publication : https://www.biorxiv.org/content/early/2018/04/30/309997

Proper citation: RRID:WB-STRAIN:WBStrain00031085 Copy   


  • RRID:WB-STRAIN:WBStrain00031084

http://www.wormbase.org/db/get?name=WBStrain00031084

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: nurf-1(kah66,kah73)II
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031084 Copy   


  • RRID:WB-STRAIN:WBStrain00031009

http://www.wormbase.org/db/get?name=WBStrain00031009

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: syIs371 III.
Notes: Made_by: Han Wang and Jonathan Liu|"syIs371"|"syIs371[15xUAS::pes-10::HisCl1::SL2::GFP::let-858 3'UTR + unc-122p::GFP + 1kb DNA ladder(NEB)]. Histamine chloride channel cGAL effector. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031009 Copy   


  • RRID:WB-STRAIN:WBStrain00031007

http://www.wormbase.org/db/get?name=WBStrain00031007

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: syIs409 X.
Notes: Made_by: Han Wang and Jonathan Liu|"syIs409"|"syIs409 [15xUAS::pes-10::mCherry::H2B::let-858 3'UTR + unc-122p::GFP + pBlueScript]. mCherry::H2B cGAL effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031007 Copy   


  • RRID:WB-STRAIN:WBStrain00031005

http://www.wormbase.org/db/get?name=WBStrain00031005

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: available
References:
Synonyms: syIs406 IV.
Notes: Made_by: Han Wang and Jonathan Liu|"syIs406 [15xUAS::pes-10::GFP::H2B::let-858 3'UTR + ttx-3p::RFP + pBlueScript]. GFP::H2B effector. Very weak background fluorescence in first ring of intestinal cells and posterior intestinal cells. Reference: Wang H, et al. Nat Methods. 2017 Feb;14(2):145-148."

Proper citation: RRID:WB-STRAIN:WBStrain00031005 Copy   


  • RRID:WB-STRAIN:WBStrain00031093

http://www.wormbase.org/db/get?name=WBStrain00031093

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: nurf-1(kah106) II/ oxTi924 II
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031093 Copy   


  • RRID:WB-STRAIN:WBStrain00031092

http://www.wormbase.org/db/get?name=WBStrain00031092

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: nurf-1(kah99)II/ oxTi924 II
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031092 Copy   


  • RRID:WB-STRAIN:WBStrain00031091

http://www.wormbase.org/db/get?name=WBStrain00031091

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: nurf-1(kah96)II/ oxTi924 II
Notes: N2 Background

Proper citation: RRID:WB-STRAIN:WBStrain00031091 Copy   


  • RRID:WB-STRAIN:WBStrain00031014

http://www.wormbase.org/db/get?name=WBStrain00031014

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00019361(clik-3)
Genomic Alteration: WBGene00019361(clik-3)
Availability: available
References:
Synonyms: K03E5.2(sy1082) I.
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of K03E5.2.Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: tatattttttgaaattttccagggaATGACCGGTT; right flanking sequence: GTCAAGGGAAAGCATTTGAAGAGAATTTGGGAGCT;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc sgRNA: ATTGCTTGGCACCTCGACGGReference: Wang H, et al. G3 (Bethesda)."

Proper citation: RRID:WB-STRAIN:WBStrain00031014 Copy   


  • RRID:WB-STRAIN:WBStrain00031018

http://www.wormbase.org/db/get?name=WBStrain00031018

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020808(clik-1)
Genomic Alteration: WBGene00020808(clik-1)
Availability: available
References:
Synonyms: clik-1(sy1084) V.
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of clik-1(T25F10.6) Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).left flanking sequence: GGAGGAGATCGAGGAGGACGAGCCAGTCGCCGACG; right flanking sequence: AGAACCAAGAGCCAGAGgtaatcgttttttgccat;inserted sequence between the two flanking sequence (STOP-IN cassette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagcReference: Wang H, et al. G3 (Bethesda)."

Proper citation: RRID:WB-STRAIN:WBStrain00031018 Copy   


  • RRID:WB-STRAIN:WBStrain00031017

http://www.wormbase.org/db/get?name=WBStrain00031017

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: T05C3.2(sy1081) V
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031017 Copy   


  • RRID:WB-STRAIN:WBStrain00031016

http://www.wormbase.org/db/get?name=WBStrain00031016

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00020254(T05C3.2)
Genomic Alteration: WBGene00020254(T05C3.2)
Availability: available
References:
Synonyms: T05C3.2(sy1080) V.
Notes: Made_by: Han Wang/Heenam Park/Wen Chen|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of T05C3.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: GTTCACCGATACAACTGTAGAACGAAACGCGCTAARight flanking sequence: TGGAGGAGATTTATCCAAAGCTTAAGGAATACTGCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : AGAACGAAACGCGCTAATGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"

Proper citation: RRID:WB-STRAIN:WBStrain00031016 Copy   


  • RRID:WB-STRAIN:WBStrain00031015

http://www.wormbase.org/db/get?name=WBStrain00031015

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: K03E5.2 (sy1083) I
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc

Proper citation: RRID:WB-STRAIN:WBStrain00031015 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X