Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Search

Type in a keyword to search

On page 20 showing 381 ~ 400 out of 64,152 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:WB-STRAIN:WBStrain00031588

http://www.wormbase.org/db/get?name=WBStrain00031588

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001470(baz-2)|WBGene00044448(ZK783.6)
Genomic Alteration: WBGene00001470(baz-2), WBGene00044448(ZK783.6)
Availability: available
References:
Synonyms: baz-2&ZK783.6(ok722) III.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00031588 Copy   


  • RRID:WB-STRAIN:WBStrain00031587

http://www.wormbase.org/db/get?name=WBStrain00031587

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00010915(nte-2)
Genomic Alteration: WBGene00010915(nte-2)
Availability: available
References:
Synonyms: M110.7(ok721) II.
Notes: M110.7. Homozygous. Outer Left Sequence: ACTTCATTCATCGCGAATCC. Outer Right Sequence: TTCTTGCACATCCAAGCAAC. Inner Left Sequence: GGAAAGTGTTTGAATGCGGT. Inner Right Sequence: AAGACTCACAGCTGCCTGGT. Inner primer WT PCR product: 2923.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031587 Copy   


  • RRID:WB-STRAIN:WBStrain00031507

http://www.wormbase.org/db/get?name=WBStrain00031507

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00022423(nhr-41)
Genomic Alteration: WBGene00022423(nhr-41)
Availability: available
References:
Synonyms: nhr-41(ok584) IV.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853."

Proper citation: RRID:WB-STRAIN:WBStrain00031507 Copy   


  • RRID:WB-STRAIN:WBStrain00031593

http://www.wormbase.org/db/get?name=WBStrain00031593

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00022278(rcor-1)
Genomic Alteration: WBGene00022278(rcor-1)
Availability: available
References:
Synonyms: Y74C9A.4(ok727).
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp."

Proper citation: RRID:WB-STRAIN:WBStrain00031593 Copy   


  • RRID:WB-STRAIN:WBStrain00031592

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031592

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006941(wnk-1)
Genomic Alteration: WBGene00006941(wnk-1)
Availability: available
References:
Synonyms: wnk-1(ok266) IV.
Notes: C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031592 Copy   


  • RRID:WB-STRAIN:WBStrain00031591

http://www.wormbase.org/db/get?name=WBStrain00031591

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011904(hlb-1)
Genomic Alteration: WBGene00011904(hlb-1)
Availability: available
References:
Synonyms: T21H8.1(ok725) X.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T21H8.1. Homozygous. Outer Left Sequence: CCATTCGTATGGTGTGCAAG. Outer Right Sequence: ACGCATTATTCGGATTCTGG. Inner Left Sequence: CATGGTCCATTTCGTTCTGA. Inner Right Sequence: AACAGGAGTGCCCACGTTAC. Inner primer WT PCR product: 2713."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031591 Copy   


  • RRID:WB-STRAIN:WBStrain00031590

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031590

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011201(nth-1)
Genomic Alteration: WBGene00011201(nth-1)
Availability: available
References:
Synonyms: nth-1(ok724) III.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R10E4.5. Homozygous. Outer Left Sequence: AGAATGCGGTAAAACGATGC. Outer Right Sequence: TGATGAATTGCATCCGAAAA. Inner Left Sequence: ACAGTGAATATGACGCGCAA. Inner Right Sequence: GCACACCTTCCTTTCTCTGC. Inner primer WT PCR product: 2170."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061894 paper added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00031590 Copy   


  • RRID:WB-STRAIN:WBStrain00031513

http://www.wormbase.org/db/get?name=WBStrain00031513

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002029(hst-2)
Genomic Alteration: WBGene00002029(hst-2)
Availability: available
References:
Synonyms: hst-2(ok595) X.
Notes: C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner primer WT PCR product: 3131.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031513 Copy   


  • RRID:WB-STRAIN:WBStrain00031511

http://www.wormbase.org/db/get?name=WBStrain00031511

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00004508(rrf-1)
Genomic Alteration: WBGene00004508(rrf-1)
Availability: available
References:
Synonyms: rrf-1(ok589) I.
Notes: F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00061131 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00031511 Copy   


  • RRID:WB-STRAIN:WBStrain00031599

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031599

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000080(adr-2)
Genomic Alteration: WBGene00000080(adr-2)
Availability: available
References:
Synonyms: adr-2(ok735) III.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T20H4.4. Homozygous. Outer Left Sequence: CTCCATATTCGCTTCCGTGT. Outer Right Sequence: AGAACACGCTCTTCGTCGAT. Inner Left Sequence: CACGATGCTGCATGAGATTT. Inner Right Sequence: AGCTCGCTTCCAATCTTCAA. Inner primer WT PCR product: 2144."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031599 Copy   


  • RRID:WB-STRAIN:WBStrain00031518

http://www.wormbase.org/db/get?name=WBStrain00031518

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003834(nxf-1)|WBGene00003835(nxf-2)
Genomic Alteration: WBGene00003834(nxf-1), WBGene00003835(nxf-2)
Availability: available
References:
Synonyms: nxf-1&nxf-2(ok611) V.
Notes: C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031518 Copy   


  • RRID:WB-STRAIN:WBStrain00031562

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031562

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002182(kap-1)
Genomic Alteration: WBGene00002182(kap-1)
Availability: available
References:
Synonyms: kap-1(ok676) II.
Notes: F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data."

Proper citation: RRID:WB-STRAIN:WBStrain00031562 Copy   


  • RRID:WB-STRAIN:WBStrain00031560

http://www.wormbase.org/db/get?name=WBStrain00031560

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00007593(C14H10.3)
Genomic Alteration: WBGene00007593(C14H10.3)
Availability: available
References:
Synonyms: C14H10.3(ok674) X.
Notes: C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031560 Copy   


  • RRID:WB-STRAIN:WBStrain00031568

http://www.wormbase.org/db/get?name=WBStrain00031568

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012532(crp-1)
Genomic Alteration: WBGene00012532(crp-1)
Availability: available
References:
Synonyms: Y32F6B.3(ok685) V.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112."

Proper citation: RRID:WB-STRAIN:WBStrain00031568 Copy   


  • RRID:WB-STRAIN:WBStrain00031601

http://www.wormbase.org/db/get?name=WBStrain00031601

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000403(casy-1)
Genomic Alteration: WBGene00000403(casy-1)
Availability: available
References:
Synonyms: casy-1(ok739) II.
Notes: B0034.3. Homozygous. Outer Left Sequence: CCTTCGCGGTTTTTATTGAA. Outer Right Sequence: CCATCATTTGTGCAATACGC. Inner Left Sequence: AAAGAAGAAAATCGTGGCGA. Inner Right Sequence: ATTGCTCACATCGAGCCTCT. Inner primer WT PCR product: 2331.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031601 Copy   


  • RRID:WB-STRAIN:WBStrain00031566

http://www.wormbase.org/db/get?name=WBStrain00031566

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001434(fkh-2)
Genomic Alteration: WBGene00001434(fkh-2)
Availability: available
References:
Synonyms: T14G12.4(ok683) X.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031566 Copy   


  • RRID:WB-STRAIN:WBStrain00031574

http://www.wormbase.org/db/get?name=WBStrain00031574

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006942(wrk-1)
Genomic Alteration: WBGene00006942(wrk-1)
Availability: available
References:
Synonyms: F41D9.3(ok695) X.
Notes: F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031574 Copy   


  • RRID:WB-STRAIN:WBStrain00031573

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031573

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006410(nck-1)
Genomic Alteration: WBGene00006410(nck-1)
Availability: available
References:
Synonyms: nck-1(ok694) X.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915."

Proper citation: RRID:WB-STRAIN:WBStrain00031573 Copy   


  • RRID:WB-STRAIN:WBStrain00031572

    This resource has 1+ mentions.

http://www.wormbase.org/db/get?name=WBStrain00031572

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013284(daf-22)
Genomic Alteration: WBGene00013284(daf-22)
Availability: available
References:
Synonyms: daf-22(ok693)
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"Supplementary_genotype daf-22(ok693) II."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202."

Proper citation: RRID:WB-STRAIN:WBStrain00031572 Copy   


  • RRID:WB-STRAIN:WBStrain00031571

http://www.wormbase.org/db/get?name=WBStrain00031571

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011156(rbm-3.2)
Genomic Alteration: WBGene00011156(rbm-3.2)
Availability: available
References:
Synonyms: R09B3.3(ok688) I.
Notes: Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."

Proper citation: RRID:WB-STRAIN:WBStrain00031571 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X