Searching the RRID Resource Information Network
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
RB875 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031588 | Caenorhabditis elegans | baz-2&ZK783.6(ok722) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK783.4 Homozygous. Outer Left Sequence: TCAGCTATCAAGCTCCGGTT. Outer Right Sequence: TGAACGTGCTCTTCATCGTC. Inner Left Sequence: CGTCATACGCCCAGAAGAAT. Inner Right Sequence: ACCAGTTGGTGAGAAATCCG. Inner Primer PCR Length: 3113. Estimated Deletion Size: about 1500 bp." | WBGene00001470(baz-2)|WBGene00044448(ZK783.6) | WBGene00001470(baz-2), WBGene00044448(ZK783.6) | WB-STRAIN:WBStrain00031588 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB875, CGC_RB875 | 2026-02-14 12:17:45 | 0 | ||
|
RB874 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031587 | Caenorhabditis elegans | M110.7(ok721) II. | M110.7. Homozygous. Outer Left Sequence: ACTTCATTCATCGCGAATCC. Outer Right Sequence: TTCTTGCACATCCAAGCAAC. Inner Left Sequence: GGAAAGTGTTTGAATGCGGT. Inner Right Sequence: AAGACTCACAGCTGCCTGGT. Inner primer WT PCR product: 2923.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00010915(nte-2) | WBGene00010915(nte-2) | WB-STRAIN:WBStrain00031587 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB874, CGC_RB874 | 2026-02-14 12:17:45 | 0 | ||
|
RB794 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031507 | Caenorhabditis elegans | nhr-41(ok584) IV. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y77E11A.5. Homozygous. Outer Left Sequence: AGGCTCACCAAGAGCTTCAA. Outer Right Sequence:AGTAACCCGAGAATTTCGCA . Inner Left Sequence: TCAATTCGAAGCCCTTTCAC. Inner Right Sequence: CATTGATGAAACCTTCCCGT. Inner primer WT PCR product: 2853." | WBGene00022423(nhr-41) | WBGene00022423(nhr-41) | WB-STRAIN:WBStrain00031507 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB794, CGC_RB794 | 2026-02-14 12:17:44 | 0 | ||
|
RB880 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031593 | Caenorhabditis elegans | Y74C9A.4(ok727). | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y74C9A.4. Homozygous. Outer Left Sequence: CATCGATTGGATCAGCTTCA. Outer Right Sequence: GCGCCCAAAAATTACAAAAA. Inner Left Sequence: GCCTGATGGTTTACGGAGAA. Inner Right Sequence: TTGATTTTCAGACGTGCAGC. Inner Primer WT PCR Product: 3251. Deletion size: 696 bp." | WBGene00022278(rcor-1) | WBGene00022278(rcor-1) | WB-STRAIN:WBStrain00031593 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB880, CGC_RB880 | 2026-02-14 12:17:45 | 0 | ||
|
RB879 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031592 | Caenorhabditis elegans | wnk-1(ok266) IV. | C46C2.1 Homozygous. Outer Left Sequence: CAAAACGACTCTGCTCCACA. Outer Right Sequence: GCAATTGTGCATGGTTTGTC. Inner Left Sequence: CAACGACATCATCTCCATCG. Inner Right Sequence: TGTCAAGTCGACACGAGACC. Inner Primer PCR Length: 3092. Estimated Deletion Size: about 1000 bp.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006941(wnk-1) | WBGene00006941(wnk-1) | WB-STRAIN:WBStrain00031592 | WormBase (WB) | WB | available | PMID:37527037 | WB-STRAIN:RB879, CGC_RB879 | 2026-02-14 12:17:45 | 1 | ||
|
RB878 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031591 | Caenorhabditis elegans | T21H8.1(ok725) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T21H8.1. Homozygous. Outer Left Sequence: CCATTCGTATGGTGTGCAAG. Outer Right Sequence: ACGCATTATTCGGATTCTGG. Inner Left Sequence: CATGGTCCATTTCGTTCTGA. Inner Right Sequence: AACAGGAGTGCCCACGTTAC. Inner primer WT PCR product: 2713."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011904(hlb-1) | WBGene00011904(hlb-1) | WB-STRAIN:WBStrain00031591 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB878, CGC_RB878 | 2026-02-14 12:17:45 | 0 | ||
|
RB877 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031590 | Caenorhabditis elegans | nth-1(ok724) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R10E4.5. Homozygous. Outer Left Sequence: AGAATGCGGTAAAACGATGC. Outer Right Sequence: TGATGAATTGCATCCGAAAA. Inner Left Sequence: ACAGTGAATATGACGCGCAA. Inner Right Sequence: GCACACCTTCCTTTCTCTGC. Inner primer WT PCR product: 2170."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain provided so WBPaper00061894 paper added based on AFP_Strain data." | WBGene00011201(nth-1) | WBGene00011201(nth-1) | WB-STRAIN:WBStrain00031590 | WormBase (WB) | WB | available | PMID:34496255 PMID:39149885 |
WB-STRAIN:RB877, CGC_RB877 | 2026-02-14 12:17:45 | 2 | ||
|
RB800 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031513 | Caenorhabditis elegans | hst-2(ok595) X. | C34F6.4. Homozygous. Outer Left Sequence: CCCTATCTACTGCCAGCGAG. Outer Right Sequence: GCGTCAGCAAAAAGAACACA. Inner Left Sequence: GAAATCGATGGAGGACGAGA. Inner Right Sequence: GCTGTGGAAAAAGCGAAAAG. Inner primer WT PCR product: 3131.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00002029(hst-2) | WBGene00002029(hst-2) | WB-STRAIN:WBStrain00031513 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB800, CGC_RB800 | 2026-02-14 12:17:44 | 0 | ||
|
RB798 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031511 | Caenorhabditis elegans | rrf-1(ok589) I. | F26A3.8. Homozygous. Outer Left Sequence: AGTCAGGAATTCGCTCAGGA. Outer Right Sequence: TCAATCATTGGCAGGTTTCA. Inner Left Sequence: GCTTGGCAATTCTTCTTTGC. Inner Right Sequence: TCGAAGGGATTCAATTCGTC. Inner primer WT PCR product: 3018.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00061131 added based on AFP_Strain data." | WBGene00004508(rrf-1) | WBGene00004508(rrf-1) | WB-STRAIN:WBStrain00031511 | WormBase (WB) | WB | available | PMID:33673074 | WB-STRAIN:RB798, CGC_RB798 | 2026-02-14 12:17:44 | 0 | ||
|
RB886 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031599 | Caenorhabditis elegans | adr-2(ok735) III. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T20H4.4. Homozygous. Outer Left Sequence: CTCCATATTCGCTTCCGTGT. Outer Right Sequence: AGAACACGCTCTTCGTCGAT. Inner Left Sequence: CACGATGCTGCATGAGATTT. Inner Right Sequence: AGCTCGCTTCCAATCTTCAA. Inner primer WT PCR product: 2144."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000080(adr-2) | WBGene00000080(adr-2) | WB-STRAIN:WBStrain00031599 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB886, CGC_RB886 | 2026-02-14 12:17:45 | 1 | ||
|
RB805 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031518 | Caenorhabditis elegans | nxf-1&nxf-2(ok611) V. | C15H11.6. Homozygous. Outer Left Sequence: GCGGACGTACCATTCAAAGT. Outer Right Sequence: ACTGCAGCCTGAAAGTTCGT. Inner Left Sequence: GGCAGAAGTAAGGCTTGCAC. Inner Right Sequence: CATGGATTGACACACCTTGC. Inner primer WT PCR product: 3088.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00003834(nxf-1)|WBGene00003835(nxf-2) | WBGene00003834(nxf-1), WBGene00003835(nxf-2) | WB-STRAIN:WBStrain00031518 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB805, CGC_RB805 | 2026-02-14 12:17:44 | 0 | ||
|
RB849 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031562 | Caenorhabditis elegans | kap-1(ok676) II. | F08F8.3. Homozygous. Outer Left Sequence: CATTTTGCTCGCTGTGAGAC. Outer Right Sequence: AACTTCTCGAACCACTGCGT. Inner Left Sequence: CCATGAATCCATGCCTCTTT. Inner Right Sequence: ATCATCAATTTGGCATGCTG. Inner primer WT PCR product: 3332.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"WBStrain mapped, WBPaper00060242 added based on AFP_Strain data." | WBGene00002182(kap-1) | WBGene00002182(kap-1) | WB-STRAIN:WBStrain00031562 | WormBase (WB) | WB | available | PMID:32916106 PMID:38302462 |
WB-STRAIN:RB849, CGC_RB849 | 2026-02-14 12:17:45 | 1 | ||
|
RB847 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031560 | Caenorhabditis elegans | C14H10.3(ok674) X. | C14H10.3. Homozygous. Outer Left Sequence: GCGAAAACTGAACACGGAAT. Outer Right Sequence: CCTTAACATGCGGCCATTAT. Inner Left Sequence: GAAAAGACGCACGAGGAAAG. Inner Right Sequence: ATTTCTGACGACTGGTTGGG. Inner primer WT PCR product: 3138.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00007593(C14H10.3) | WBGene00007593(C14H10.3) | WB-STRAIN:WBStrain00031560 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB847, CGC_RB847 | 2026-02-14 12:17:45 | 0 | ||
|
RB855 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031568 | Caenorhabditis elegans | Y32F6B.3(ok685) V. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y32F6B.3. Homozygous. Outer Left Sequence: CCCATTCTCGTCCACTTTGT. Outer Right Sequence: GTGATCCCATTCCAAAATGC. Inner Left Sequence: GAAGACAACGCCTCTGGAAG. Inner Right Sequence: AGGAAAATGGGTGAGCAATG. Inner primer WT PCR product: 2112." | WBGene00012532(crp-1) | WBGene00012532(crp-1) | WB-STRAIN:WBStrain00031568 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB855, CGC_RB855 | 2026-02-14 12:17:45 | 0 | ||
|
RB888 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031601 | Caenorhabditis elegans | casy-1(ok739) II. | B0034.3. Homozygous. Outer Left Sequence: CCTTCGCGGTTTTTATTGAA. Outer Right Sequence: CCATCATTTGTGCAATACGC. Inner Left Sequence: AAAGAAGAAAATCGTGGCGA. Inner Right Sequence: ATTGCTCACATCGAGCCTCT. Inner primer WT PCR product: 2331.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00000403(casy-1) | WBGene00000403(casy-1) | WB-STRAIN:WBStrain00031601 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB888, CGC_RB888 | 2026-02-14 12:17:45 | 0 | ||
|
RB853 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031566 | Caenorhabditis elegans | T14G12.4(ok683) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"T14G12.4. Homozygous. Outer Left Sequence: AATAATCGACGTTTGACGGC. Outer Right Sequence: TAATCATCCTTGGAAACGCC. Inner Left Sequence: TTGGTGTTACAAGCACGGAA. Inner Right Sequence: ATCGCAGTGGTTAGTCCCAC. Inner primer WT PCR product: 2102."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00001434(fkh-2) | WBGene00001434(fkh-2) | WB-STRAIN:WBStrain00031566 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB853, CGC_RB853 | 2026-02-14 12:17:45 | 0 | ||
|
RB861 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031574 | Caenorhabditis elegans | F41D9.3(ok695) X. | F41D9.3. Homozygous. Outer Left Sequence: TGACACTGTTGCAGTCCTCC. Outer Right Sequence: ACAGAAGTCGTCGCTGTTGA. Inner Left Sequence: GCAGAAAGTGATCCGCATTT. Inner Right Sequence: TAACTACTCGTGCGCATTGG. Inner primer WT PCR product: 3367.|"Made_by: OMRF Knockout Group"|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00006942(wrk-1) | WBGene00006942(wrk-1) | WB-STRAIN:WBStrain00031574 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB861, CGC_RB861 | 2026-02-14 12:17:45 | 0 | ||
|
RB860 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031573 | Caenorhabditis elegans | nck-1(ok694) X. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"ZK470.5. Homozygous. Outer Left Sequence: TCTTGCCAGCCTTCATTCTT. Outer Right Sequence: TGTTGGATTTGTGCCTTCAA. Inner Left Sequence: TTCACCAACTTTGGCAACTG. Inner Right Sequence: GAACAATCAAGGGCTTAGCG. Inner primer WT PCR product: 2915." | WBGene00006410(nck-1) | WBGene00006410(nck-1) | WB-STRAIN:WBStrain00031573 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB860, CGC_RB860 | 2026-02-14 12:17:45 | 1 | ||
|
RB859 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031572 | Caenorhabditis elegans | daf-22(ok693) | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"Supplementary_genotype daf-22(ok693) II."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use."|"Y57A10C.6. Homozygous. Outer Left Sequence: AAGTTTGGTTGCCCAGTGAA. Outer Right Sequence: CCTGGCTACGTAGTTCCCAA. Inner Left Sequence: ACTTTTCCGATTTTCCGGTT. Inner Right Sequence: TCGTTGGAGTCGGTATGACA. Inner primer WT PCR product: 2202." | WBGene00013284(daf-22) | WBGene00013284(daf-22) | WB-STRAIN:WBStrain00031572 | WormBase (WB) | WB | available | PMID:34460264 PMID:34534386 PMID:37624117 PMID:37729202 |
WB-STRAIN:RB859, CGC_RB859 | 2026-02-14 12:17:45 | 2 | ||
|
RB858 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031571 | Caenorhabditis elegans | R09B3.3(ok688) I. | Made_by: OMRF Knockout Group|"Mutagen:UV/TMP"|"R09B3.3. Homozygous. Outer Left Sequence: CGTTGTTGATTTGTCCGATG. Outer Right Sequence: TGGTCTCCGCTCGTTCTACT. Inner Left Sequence: TGACGGTTTAATTTTTCCGC. Inner Right Sequence: CAGGATCTCAAGTGCCTCGT. Breaks are at R09B3 coordinates 4090/5259. Inner primer WT PCR product: 2206."|"This strain was provided by the C. elegans Gene Knockout Project at the Oklahoma Medical Research Foundation, which was part of the International C. elegans Gene Knockout Consortium, which should be acknowledged in any publications resulting from its use." | WBGene00011156(rbm-3.2) | WBGene00011156(rbm-3.2) | WB-STRAIN:WBStrain00031571 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:RB858, CGC_RB858 | 2026-02-14 12:17:45 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
