Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Mentions:yes (facet)

Facets

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

5,761 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pCS2-MT mouse Axin (Axin MTFu1)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_21287 Axin Mus musculus Ampicillin PMID:9230313 Backbone Size:4300; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-12-10 12:04:24 1
pcDNA3.1_iSH2-pMagFast2(3x)-iRFP
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_67298 iSH2-pMagFast2(3x)-iRFP Homo sapiens Ampicillin PMID:25708714 Backbone Marker:Invitrogen; Backbone Size:5354; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-12-10 12:06:25 1
Flag-Gsdmd
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_80950 Gsdmd Mus musculus Ampicillin PMID:27383986 Backbone Marker:Sigma; Vector Backbone:pFlag-CMV-4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-12-09 12:07:07 1
hMSH2 Clone E3 (full-length)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_16453 MSH2 Homo sapiens Ampicillin PMID:8261515 A full-length clone of hMSH2 cDNA was cloned into the XbaI/XhoI site of pBluescript SK. Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-11-28 12:02:58 1
pGL3-Sox2
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101761 SRY-box 2 promoter Homo sapiens Ampicillin PMID:29593326 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2022-04-22 03:15:09 1
pGL3-TGFb1
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101762 transforming growth factor beta 1 promoter Homo sapiens Ampicillin PMID:29593326 Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin 2022-04-22 03:15:09 2
5TEY (METTL3)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_101892 METTL3 Homo sapiens Ampicillin PMID: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: METTL3:JMC094-C09:C231635. SGC or PDG link: http://www.thesgc.org/structures/5TEY/ Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 62304); Vector Backbone:pFBOH-MHL; Vector Types:Other, Baculovirus expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:12 1
pPB-CAG-rtTA-IRES-Hygro
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102423 tetracyclin-transactivator (rtTA) Ampicillin PMID:28504700 IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers: Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:15 2
Pink Flamindo
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102356 Pink Flamindo Ampicillin PMID:28779099 Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:13 3
pCMV4a-Flag-c-Myc
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102625 MYC Homo sapiens Kanamycin PMID:26977881 Backbone Size:4319; Vector Backbone:pCMV-Tag-4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2022-04-22 03:15:17 1
pcDNA3.1-Hygro(+)-mscGAS
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102607 cGAS Mus musculus Ampicillin PMID:26229115 Vector Backbone:pcDNA3.1-Hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:17 1
p11d-tRPA(123)
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102613 RPA1 Homo sapiens Ampicillin PMID:8157639 Vector Backbone:pET11d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:15:17 1
STAGR_SAMScaffold_hU6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102843 gRNAScaffold_hU6promoter Kanamycin PMID:29702666 Backbone Size:3250; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:Other, as PCR template; Bacterial Resistance:Kanamycin 2022-04-22 03:15:20 1
STAGR_gRNAScaffold_mU6
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102844 STAgR Insert gRNAScaffold_mU6 Kanamycin PMID:29702666 Backbone Marker:Stricker Lab; Vector Backbone:PCR Template for STAgR Reactions; Vector Types:Other, PCR Template for STAgR Inserts; Bacterial Resistance:Kanamycin 2022-04-22 03:15:20 1
pAAV-CMV-FLEX-TVAmCherry-2A-oG
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102985 TVA-mCherry fusion protein after CRE-mediated recombination Ampicillin PMID:28689641 Vector Backbone:pAAV; Vector Types:AAV, Other, Adeno Associated Viral Vector; Bacterial Resistance:Ampicillin 2022-04-22 03:15:23 1
STAgR_Neo
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_102992 Ampicillin PMID:29702666 Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, Other, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin 2022-04-22 03:15:23 1
BE4-Gam
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100806 BE4-Gam Rattus norvegicus Ampicillin PMID:28875174 Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:14:57 1
CDA1-BE3
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100804 CDA1-BE3 Synthetic Ampicillin PMID:28875174 Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:14:57 1
pAAV.Syn.GCaMP6s.WPRE.SV40
 
Resource Report
Resource Website
10+ mentions 		RRID:Addgene_100843 GCaMP6s Synthetic Ampicillin PMID:23868258 This plasmid was previously available as pAAV.Syn.GCaMP6s.WPRE.SV40( p2824) from the Penn Vector Core. This plasmid was created as part of the GENIE project at Janelia Research Campus. Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin GCaMP3-K78H T302L R303P D380Y T381R S383T R392G 2022-04-22 03:14:57 16
pAAV.Syn.Flex.GCaMP6m.WPRE.SV40
 
Resource Report
Resource Website
1+ mentions 		RRID:Addgene_100838 GCaMP6m Synthetic Ampicillin PMID:23868258 This plasmid was previously available as pAAV.Syn.Flex.GCaMP6m.WPRE.SV40 (p2820) from the Penn Vector Core. This plasmid was created as part of the GENIE project at Janelia Research Campus. Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin GCaMP3-T302L R303P M378G K379S D380Y T381R S383T R392G 2022-04-22 03:14:57 3

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.

Recent News Entries

New Release: NeuroMorpho.Org Version 8.6 (12/4/23), with 14,452 new tracings from 45 datasets

Dr. Martone on BrainFacts.org a FAIR video

With 2023 there are new NIH guidelines on data deposition, are you ready?

Contact Us

FAIR Data Informatics Lab

University of California, San Diego
9500 Gilman Drive, Mail Code 0608
La Jolla, CA 92093-0608
United States

info  scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch