Species: Other
Genetic Insert: E. coli AlkB
Vector Backbone Description: Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_160433 Copy
Species: Other
Genetic Insert: 35s
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pUPD; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments: Compatible with GoldenBraid; insert can be released with BsaI
Proper citation: RRID:Addgene_160554 Copy
Species: Other
Genetic Insert: E. coli AlkB
Vector Backbone Description: Backbone Size:5295; Vector Backbone:pET-28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_160434 Copy
Species: Mus musculus
Genetic Insert: tandem HRS FYVE domain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEGFP-C3; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_140047 Copy
Species: Synthetic
Genetic Insert: Con/Fon-ChRmine-p2a-oScarlet
Vector Backbone Description: Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
References:
Comments: Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG
Proper citation: RRID:Addgene_137159 Copy
Species: Homo sapiens
Genetic Insert: Abeta(MC1-42)
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pET vector; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_127151 Copy
Species: Homo sapiens
Genetic Insert: SLC17A1
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_131888 Copy
Species: Homo sapiens
Genetic Insert: SLC7A14
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_132173 Copy
Species: Homo sapiens
Genetic Insert: SLC25A22
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_132051 Copy
Species: Synthetic
Genetic Insert: Coff/Fon-ChRmine-p2a-oScarlet
Vector Backbone Description: Backbone Size:4600; Vector Backbone:AAV2-nEF-WPRE; Vector Types:AAV, Cre/Lox, Synthetic Biology, Flp/FRT; Bacterial Resistance:Ampicillin
References:
Comments: Additional sequencing primers: Intron 2F GGGACGACATGACTTAACCAG; Intron 2R CCAGCCCTTCTCATGTTCAG; Intron 1F CCTGTATGTGACCCATGTGC; Intron 1R: GCACATGGGTCACATACAGG
Proper citation: RRID:Addgene_137160 Copy
Species: Other
Genetic Insert: SSB-mTur2
Vector Backbone Description: Backbone Size:5382; Vector Backbone:pET21a; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_136473 Copy
Species: Synthetic
Genetic Insert: Cas9m4-KRAB-MeCP2
Vector Backbone Description: Backbone Marker:Andrea Califano; Vector Backbone:PB-TRE-dCas9-KRAB-MeCP2; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: This is a lentiviral vector (modified in #122205; originally from Weissman lab #85969) with a Tet-ON 3G dCas9m4-KRAB-MeCP2 (Church lab; #63800). Note: the vector has been modified to use blasticidin selection.
Proper citation: RRID:Addgene_140690 Copy
Species: Other
Genetic Insert: ORF73
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCDNA4.TO; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_136232 Copy
Species: Mus musculus
Genetic Insert: Slc32a1
Vector Backbone Description: Backbone Marker:Larry Zweifel (Addgene plasmid # 124844); Vector Backbone:pAAV-FLEX-SaCas9-U6-sgRNA; Vector Types:Mouse Targeting, AAV, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_159905 Copy
Species: Synthetic
Genetic Insert: AcrIIA4
Vector Backbone Description: Backbone Marker:self-made; derived from the BioBrick assembly plasmid pSB1C3 ; Vector Backbone:pUPD2; Vector Types:Synthetic Biology; Bacterial Resistance:Chloramphenicol
References:
Comments: Compatible with GoldenBraid; insert can be released with BsaI
Proper citation: RRID:Addgene_160605 Copy
Species: Synthetic
Genetic Insert: Multiplexing Edit (En-1)
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments: Compatible with GoldenBraid; insert can be released with BsmBI
Proper citation: RRID:Addgene_160564 Copy
Species: Homo sapiens
Genetic Insert: SLC25A39
Vector Backbone Description: Backbone Marker:ThermoFisher Scientific; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: This plasmid contains a STOP codon at the end of the codon-optimized ORF. For the version of this plasmid that does not contain a STOP codon, please see Addgene plasmid 131970 For more information on the full Resolute plasmid collection, please see www.addgene.org/depositor-collections/re-solute/. Please provide your feedback on this plasmid to the RESOLUTE consortium by filling out their RESOLUTE repository feedback form: https://forms.office.com/Pages/ResponsePage.aspx?id=0e05yklzmkS7rjFGQL4N7z4feCLQvEJAmVcOCM_u885UN1JJRko0Ukg4TVQwNTZLOUxPQVJWT1NHUCQlQCN0PWcu
Proper citation: RRID:Addgene_161136 Copy
Species: Synthetic
Genetic Insert: tRNA-gRNA position E4-En-1 (Multiplexing Edit)
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments: Compatible with GoldenBraid; insert can be released with BsmBI
Proper citation: RRID:Addgene_160565 Copy
Species: Synthetic
Genetic Insert: Multiplexing Edit (E3-E4-En-1)
Vector Backbone Description: Backbone Marker:self-made; derived from pGEMT-Easy manufactured by Promega; Vector Backbone:pVD1; Vector Types:CRISPR, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments: Compatible with GoldenBraid; insert can be released with BsmBI
Proper citation: RRID:Addgene_160566 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:3267; Vector Backbone:pGT2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: pGT2 is an XcmI generated T-vector bearing GFP marker optimized for direct cloning.
Colonies with insert are selected by GFP inactivation.
Proper citation: RRID:Addgene_13056 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.