Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
E. coli MEV20 Resource Report Resource Website |
RRID:Addgene_197113 | None | PMID: | E. coli MEV15 is engineered to host diterpenoid biosynthetic pathways. Diterpenoid production is achieved by supplying the strain with plasmids encoding terpene cyclase(s) and cytochrome P450s under the control of Marionette promoters (See https://www.addgene.org/kits/marionette-sensor-collection/ and 10.1038/s41589-018-0168-3). Diterpenoid production can be induced by IPTG, vanillic acid, and other inducers controlling cytorhcome P450s. The strain has the upper MEV pathway from pMevT (addgene #17815) inserted into 4418413/4418414, the lower MEV pathway from pMBIS (addgene #17817) and Streptomyces avermitilis ggps inserted into 4105665/4105664, the designed redox enzyme array inserteed into 3801913/3801912, and the Marionette cluster from sAJM.1506 (addgene #108254) inserted into 3753777/3752159 of E. coli BL21(DE3)'s genome. The nucleotide numbers are based on NCBI accession # NZ_CP053602. The redox enzyme array consists of fprD/fdxD from Streptomyces avermitilis, fpr/fldA from E. coli, fenr/fer1 from spinach chloroplasts, abd pdr/pdx (camA/camB) from Pseudomonas putida. The Marionette cluster was transferred using phage transduction, resulting in the replacement of nucleotides between 3745758/3839292 by those in the corresponding regions from sAJM.1506 (parent strain: E. coli MG1655), as evident by whole-genome sequencing. | Vector Backbone:N/A; Vector Types:; Bacterial Resistance:None | 2023-11-19 12:04:51 | 0 | |||
|
BL21 ΔrecB Resource Report Resource Website |
RRID:Addgene_176580 | Strain | None | PMID:35034449 | Please visit https://www.biorxiv.org/content/10.1101/2021.09.07.459228v1 for bioRxiv preprint. Primers for recB deletion verification: Foward - tattttccagtcgtgaaagc Reverse - ttgctgatttcttccatcag | Vector Backbone:Strain; Vector Types:; Bacterial Resistance:None | recB genomic deletion | 2024-03-08 12:04:13 | 0 | |
|
EH1 Resource Report Resource Website |
RRID:Addgene_102804 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= thrC ilvA Precursor strain = RF2 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Thr, Ile EH1 requires L-Thr and L-Ile for growth in M63 minimal medium Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2024-03-03 12:00:17 | 0 | ||
|
RF16 Resource Report Resource Website |
RRID:Addgene_102800 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB trpA trpB glyA serB cysE Precursor strain = RF15 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Trp, (Phe), Gly, Ser, Cys++++++, Ala++++++ ++++++ RF16 grows slowly in the LB medium, does NOT grow in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser plus L-Cys. RF16 (but not RF15) grows very slowly in M63 minimal medium in the presence of L-Asp, L-Tyr, L-Trp, L-Gly, L-Ser, L-Cys plus L-Ala. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2024-03-03 12:00:16 | 0 | ||
|
RF17 Resource Report Resource Website |
RRID:Addgene_102801 | none | None | PMID:33289521 | This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant. Genotype= aspC tyrB ilvE Precursor strain = RF4 Modified from the parent Escherichia coli BL21(DE3) strain Selective amino acid labeling (and/or requirement) = Asp, Tyr, Phe, Ile, Leu Please note- RF17 strain has knockouts in aspC, tyrB, and ilvE genes and requires the presence of L-Asp, L-Tyr, L-Phe, L-Ile plus L-Leu for (slow) growth in M63 minimal medium. Please visit the following links for additional details on this strain and selective amino acid labeling- http://www2.nms.ac.jp/fesworld/EcoliStrains.html http://www2.nms.ac.jp/fesworld/EcoliStrainsSuppl.html Note that these strains are NOT competent cells and one needs to make them competent before use. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. Supporting References: Lin, M. T., Fukazawa, R., Miyajima-Nakano, Y., Matsushita, S., Choi, S. K., Iwasaki, T., and Gennis, R. B. (2015) Escherichia coliauxotroph host strains for amino acid-selective isotope labeling of recombinant proteins. Methods Enzymol. (Isotope Labeling of Biomolecules - Labeling Methods), 565, 45-66. Iwasaki, T., Fukazawa, R., Miyajima-Nakano, Y., Baldansuren, A., Matsushita, S., Lin, M. T., Gennis, R. B., Hasegawa, K., Kumasaka, T., and Dikanov, S. A. (2012) Dissection of hydrogen bond interaction network around an iron-sulfur cluster by site-specific isotope labeling of hyperthermophilic archaeal Rieske-type ferredoxin. J. Am. Chem. Soc. 134, 19731-19738. Lin, M. T., Sperling, L. J., Frericks Schmidt, H. L., Tang, M., Samoilova, R. I., Kumasaka, T., Iwasaki, T., Dikanov, S. A., Rienstra, C. M., and Gennis, R. B. (2011) A rapid and robust method for selective isotope labeling of proteins. Methods 55, 370-378. | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2024-03-03 12:00:17 | 0 | ||
|
bMS.346 Resource Report Resource Website |
RRID:Addgene_220588 | exoI- recJ- araB::T7RNAP-tetA | Other | None | PMID:34949838 | Strain was validated by shotgun sequencing using Illumina Nextseq. Supporting References: Bhattarai-Kline, S., Lear, S.K., Fishman, C.B. et al. Recording gene expression order in DNA by CRISPR addition of retron barcodes. Nature 608, 217–225 (2022). https://doi.org/10.1038/s41586-022-04994-6. González-Delgado A, Lopez SC, Rojas-Montero M, Fishman CB, Shipman SL. Simultaneous multi-site editing of individual genomes using retron arrays. bioRxiv [Preprint]. 2023 Jul 17:2023.07.17.549397. doi: 10.1101/2023.07.17.549397. PMID: 37503029; PMCID: PMC10370050. | Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None | 2024-08-01 01:07:17 | 0 | |
|
pMBA334 Resource Report Resource Website |
RRID:Addgene_214746 | BBa_J23119-RiboJ-RBS(21992)-gfpmut3 | Other | None | PMID:38086386 | Vector Backbone:colE1 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2024-08-01 01:06:42 | 0 | ||
|
pMBA327 Resource Report Resource Website |
RRID:Addgene_214747 | BBa_J23119-RBS(22821)-mcherry | Other | None | PMID:38086386 | Please note: Plasmid contains three mutations in Rep101. These mutations are not known to affect plasmid function. | Vector Backbone:pSC101 ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2024-08-01 01:06:42 | 0 | |
|
pMBA328 Resource Report Resource Website |
RRID:Addgene_214748 | BBa_J23119-RBS(22821)-mcherry | Other | None | PMID:38086386 | Please note: Plasmid contains R334H and A76T mutations in glmS. These mutations are not known to affect plasmid function. | Vector Backbone:p15A ; Vector Types:Bacterial Expression; Bacterial Resistance:None | 2024-08-01 01:06:42 | 0 | |
|
pSELECT-HA-mFOXO1 Resource Report Resource Website |
RRID:Addgene_83308 | FoxO1 | Mus musculus | None | PMID:27511131 | To construct pSELECT-HA-mFOXO1 the coding sequence of HA tag and FOXO1 were amplified from pCMV-HA-FOXO1 by PCR. The PCR product was digested with NheI and SalI restriction enzymes and inserted into the NheI and SalI sites of pSELECT-puro. The insert was sequenced and compared to mouse FOXO1 (NM_019739.3). Sequence identity was confirmed except for a conservative A->G mutation at base 474, a non-conservative A->G mutation at base 1121 and a non-conservative mutation T->C mutation at base 2321 of NM_019739.3. These mutations were confirmed to exist in the original pCMV-HA-FOXO1 plasmid. The non-conservative mutations result in a K->R substitution at amino acid 219 and a L->P substitution at amino acid 619 of mFOXO1 (NP_062713.2). Mutations at bases 1121 and 2321 were reversed to wild type by site-directed mutagenesis and the corrections were confirmed by sequencing | Backbone Marker:Invivogen; Backbone Size:3390; Vector Backbone:pSELECT-puro; Vector Types:Mammalian Expression; Bacterial Resistance:None | 2024-08-01 01:10:12 | 0 | |
|
JEC027 Resource Report Resource Website |
RRID:Addgene_180310 | None | PMID:35077145 | Genotype: E. coli MG1655ΔCRISPR-Cas Method: Knockout using pKD46/pKD4 Created by: Baiyang Liu Knockout region from MG1655 genome: 995605 to 1006007 Primer Fw: GATTATCGACTGGGATAACC Primer Rv: CAGAAATATTCGACAAAGCG Expected PCR size for JEC027: 1kb Expected PCR size for MG1655: 10.4kb | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2024-08-01 01:04:46 | 0 | |||
|
BL21(DE3) ΔserC Resource Report Resource Website |
RRID:Addgene_197656 | This strain is a derivative of BL21(DE3) with the serC gene knocked out | Other | None | PMID:37122473 | Strain is resistant to chloramphenicol. Derivative of BL21(DE3) with the serC gene knocked out. This strain is used for expressing proteins containing site-specific non-hydrolyzable phosphoserine. Primers for verification: - for serC deletion: CCTCAACGGTTTTACTCATTGCGATG, CGGGCAGATTAATAGTGCCATCGAC Additional reference: Rogerson et al. Efficient genetic encoding of phosphoserine and its nonhydrolyzable analog. Nat Chem Biol. 2015 Jul;11(7):496-503 Please visit https://www.biorxiv.org/content/10.1101/2021.10.22.465468v2 for bioRxiv preprint. | Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None | 2025-02-05 01:07:11 | 0 | |
|
TB205 △ilvA Resource Report Resource Website |
RRID:Addgene_230042 | MG1655 attP21::PR-mCherry::frt ilvA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: ilvA_fwd: ATCGTGAACGTCAGGTCTCC ilvA_rev: TCTGGAAGATTTTGCCGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2025-02-01 04:09:14 | 0 | ||
|
TB204 △ilvA Resource Report Resource Website |
RRID:Addgene_230041 | MG1655 attP21::PR-sfGFP::frt ilvA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- isoleucine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: ilvA_fwd: ATCGTGAACGTCAGGTCTCC ilvA_rev: TCTGGAAGATTTTGCCGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2025-02-01 04:09:14 | 0 | ||
|
TB205 △metA Resource Report Resource Website |
RRID:Addgene_230040 | MG1655 attP21::PR-mCherry::frt metA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: metA_fwd: CGTGAGCGGCGAATACTAAT metA_rev: AAACTTCCCCACTGTGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2025-02-01 04:09:14 | 0 | ||
|
TB204 △proC Resource Report Resource Website |
RRID:Addgene_230035 | MG1655 attP21::PR-sfGFP::frt proC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: proC_fwd: CATAAAGTCATCCTTTGTTGGG proC_rev: CTTTACGGATTAGTGTGGGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2025-02-01 04:09:14 | 0 | ||
|
TB204 △metA Resource Report Resource Website |
RRID:Addgene_230039 | MG1655 attP21::PR-sfGFP::frt metA::frt | None | PMID:37903278 | Strain Validation: Fluorescence, growth in M9+glucose +/- methionine, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: metA_fwd: CGTGAGCGGCGAATACTAAT metA_rev: AAACTTCCCCACTGTGAAC | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2025-02-01 04:09:14 | 0 | ||
|
TB205 △proC Resource Report Resource Website |
RRID:Addgene_230036 | MG1655 attP21::PR-mCherry::frt proC::frt | None | PMID:32042125 | Strain Validation: Fluorescence, growth in M9+glucose +/- proline, PCRs with primers flanking fluorescent marker gene or deleted gene. Primers: proC_fwd: CATAAAGTCATCCTTTGTTGGG proC_rev: CTTTACGGATTAGTGTGGGG | Vector Backbone:NA; Vector Types:; Bacterial Resistance:None | 2025-02-01 04:09:14 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
