Species: Synthetic
Genetic Insert: anti-GFP FLIPPER-body
Vector Backbone Description: Backbone Size:5371; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_112157 Copy
Species: Homo sapiens
Genetic Insert: ABEmax
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_112095 Copy
Species: Homo sapiens
Genetic Insert: AncBE4max
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_112094 Copy
Species: Synthetic
Genetic Insert: SpyCatcher-mi3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_112255 Copy
Species: Homo sapiens
Genetic Insert: CUX1
Vector Backbone Description: Backbone Marker:Zhang lab (Addgene plasmid ID: 42230); Vector Backbone:pX330; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: gRNA sequence listed includes 20 nucleotide target sequence, followed by the uncloned PAM sequence. The PAM sequence is not present in the plasmid. Use with plasmid pCUX1-donor.
Proper citation: RRID:Addgene_112434 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pBAT4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_112592 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5270; Vector Backbone:pRS410; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments: pRS400 + pRS415 --> pRS410. Insert is KanMX (G418 resistance) from AatII-cut pRS400. Backbone is ApaLI-cut pRS415 (CEN plasmid).
Proper citation: RRID:Addgene_11258 Copy
Species: Homo sapiens
Genetic Insert: INPP4B
Vector Backbone Description: Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/06/410811 for bioRxiv preprint.
Proper citation: RRID:Addgene_116865 Copy
Species: Other
Genetic Insert: SYP-HRP
Vector Backbone Description: Backbone Size:5611; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117186 Copy
Species: Homo sapiens
Genetic Insert: SMAD2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_11734 Copy
Species: Mus musculus
Genetic Insert: Egr-1
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_11729 Copy
Species: Homo sapiens
Genetic Insert: DPP6
Vector Backbone Description: Backbone Marker:Genescript; Backbone Size:5400; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_117272 Copy
Species: Homo sapiens
Genetic Insert: ALK2
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_11740 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin
References:
Comments: Use the BseRI enzyme to clone gRNA of interest in the U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert
Proper citation: RRID:Addgene_118840 Copy
Species:
Genetic Insert: STOP
Vector Backbone Description: Backbone Size:3806; Vector Backbone:n/a; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: pBS302 carries two directly repeated loxP sites flanking a synthetic DNA sequence designated "STOP." The lox-square STOP cassette sits on a NotI fragment that can excised and gel-purified for injection into fertilized zygotes. The STOP sequence is designed to thwart productive expression of a downstream gene under the control of an upstream promoter (to be inserted in the SfiI-SpeI polylinker region). It will have been removed in cells expressing Cre, or in descendants of cells that previously had expressed Cre, because of Cre-mediated recombination at the loxP sites. The STOP sequence is the same as used to regulate T-Ag expression in pBS241.
Proper citation: RRID:Addgene_11925 Copy
Species: Other
Genetic Insert: E4, E2a and VA
Vector Backbone Description: Vector Backbone:unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_112867 Copy
Species:
Genetic Insert: 4 bulged binding sites for CXCR4 siRNA antisense
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin
References:
Comments: Two original binding sites, separated by 4 nt, were flanked by two of the orginal bulged binding sites, each 11 nt away.
Flanking CXCR4 sites, with XhoI and SpeI restriction sites between them, were inserted into the XbalI site in the 3' UTR of the pRL-TK plasmid. The inner binding sites were then inserted by ligating annealed oligos into the XhoI and SpeI sites.
See Addgene plasmid 11307 for cloning of binding sites into the backbone, used in Doench, Sharp 2003 paper.
Proper citation: RRID:Addgene_11313 Copy
Species: Mus musculus
Genetic Insert: Foxo1
Vector Backbone Description: Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Note that a BLAST search with Addgene's quality control sequence shows a K219R mutation. The Accili lab has explained that this is a common variant and they do not consider it a mutation at all. They have used the plasmid routinely without issue. The plasmid also contains an L619P polymorphism.
Proper citation: RRID:Addgene_12148 Copy
Species: Homo sapiens
Genetic Insert: IFIT5
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_53561 Copy
Species: Mus musculus
Genetic Insert: PKC epsilon
Vector Backbone Description: Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21243 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.