Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.1 SP-His-mCherry-HRP-VhHGFP Resource Report Resource Website 1+ mentions |
RRID:Addgene_112157 | anti-GFP FLIPPER-body | Synthetic | Ampicillin | PMID:29327239 | Backbone Size:5371; Vector Backbone:pcDNA3.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:00 | 1 | ||
|
pCMV_ABEmax Resource Report Resource Website 1+ mentions |
RRID:Addgene_112095 | ABEmax | Homo sapiens | Ampicillin | PMID:29813047 | Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2022-04-22 03:17:59 | 1 | ||
|
pCMV_AncBE4max Resource Report Resource Website 1+ mentions |
RRID:Addgene_112094 | AncBE4max | Homo sapiens | Ampicillin | PMID:29813047 | Vector Backbone:pCMV; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2022-04-22 03:17:59 | 2 | ||
|
pET28a-SpyCatcher-mi3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112255 | SpyCatcher-mi3 | Synthetic | Kanamycin | PMID:30028591 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:18:01 | 1 | ||
|
pCUX1.1.0-gDNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_112434 | CUX1 | Homo sapiens | Ampicillin | PMID: | gRNA sequence listed includes 20 nucleotide target sequence, followed by the uncloned PAM sequence. The PAM sequence is not present in the plasmid. Use with plasmid pCUX1-donor. | Backbone Marker:Zhang lab (Addgene plasmid ID: 42230); Vector Backbone:pX330; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:03 | 1 | |
|
pMAT11 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112592 | Ampicillin | PMID:8660525 | Vector Backbone:pBAT4; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:05 | 1 | ||||
|
pRS410 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11258 | Ampicillin | PMID: | pRS400 + pRS415 --> pRS410. Insert is KanMX (G418 resistance) from AatII-cut pRS400. Backbone is ApaLI-cut pRS415 (CEN plasmid). | Backbone Size:5270; Vector Backbone:pRS410; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:05 | 1 | |||
|
mCherry-FKBP-INPP4BC842A Resource Report Resource Website 1+ mentions |
RRID:Addgene_116865 | INPP4B | Homo sapiens | Kanamycin | PMID:30591513 | Please visit https://www.biorxiv.org/content/early/2018/09/06/410811 for bioRxiv preprint. | Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | catalytic cysteine 842 changed to alanine | 2022-04-22 03:19:27 | 1 |
|
pAAV-DIO-SYP-HRP Resource Report Resource Website 1+ mentions |
RRID:Addgene_117186 | SYP-HRP | Other | Ampicillin | PMID:30886406 | Backbone Size:5611; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV, Cre/Lox; Bacterial Resistance:Ampicillin | 2022-04-22 03:19:31 | 1 | ||
|
pCMV5B-HA-Smad2 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11734 | SMAD2 | Homo sapiens | Ampicillin | PMID:8752209 | Backbone Size:4700; Vector Backbone:pCMV5B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:19:33 | 1 | ||
|
pcDNA3-Egr1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11729 | Egr-1 | Mus musculus | Ampicillin | PMID:15225550 | Backbone Size:5400; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:19:32 | 1 | ||
|
pcDNA3.1+DPP6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_117272 | DPP6 | Homo sapiens | Ampicillin | PMID:29378180 | Backbone Marker:Genescript; Backbone Size:5400; Vector Backbone:pcDNA3.1+; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:19:32 | 1 | ||
|
pCMV5-ALK2 Q207D Resource Report Resource Website 1+ mentions |
RRID:Addgene_11740 | ALK2 | Homo sapiens | Ampicillin | PMID:9748228 | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | Q207D: activated receptor | 2022-04-22 03:19:34 | 1 | |
|
MiniCoopR U6:gRNA, mitfa:Cas9 Resource Report Resource Website 1+ mentions |
RRID:Addgene_118840 | Ampicillin | PMID:30385465 | Use the BseRI enzyme to clone gRNA of interest in the U6:gRNA cassette. Use primer: CCATACCACATTTGTAGAGGT to sequence insert | Vector Backbone:MiniCoopR; Vector Types:CRISPR, Other, Tol2; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:01 | 1 | |||
|
pBS302 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11925 | STOP | Ampicillin | PMID:8231893 | pBS302 carries two directly repeated loxP sites flanking a synthetic DNA sequence designated "STOP." The lox-square STOP cassette sits on a NotI fragment that can excised and gel-purified for injection into fertilized zygotes. The STOP sequence is designed to thwart productive expression of a downstream gene under the control of an upstream promoter (to be inserted in the SfiI-SpeI polylinker region). It will have been removed in cells expressing Cre, or in descendants of cells that previously had expressed Cre, because of Cre-mediated recombination at the loxP sites. The STOP sequence is the same as used to regulate T-Ag expression in pBS241. | Backbone Size:3806; Vector Backbone:n/a; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:11 | 1 | ||
|
pAdDeltaF6 Resource Report Resource Website 1+ mentions |
RRID:Addgene_112867 | E4, E2a and VA | Other | Ampicillin | PMID: | Vector Backbone:unknown; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:09 | 6 | ||
|
pRL-TK 4x wt Resource Report Resource Website 1+ mentions |
RRID:Addgene_11313 | 4 bulged binding sites for CXCR4 siRNA antisense | Ampicillin | PMID:15014042 | Two original binding sites, separated by 4 nt, were flanked by two of the orginal bulged binding sites, each 11 nt away. Flanking CXCR4 sites, with XhoI and SpeI restriction sites between them, were inserted into the XbalI site in the 3' UTR of the pRL-TK plasmid. The inner binding sites were then inserted by ligating annealed oligos into the XhoI and SpeI sites. See Addgene plasmid 11307 for cloning of binding sites into the backbone, used in Doench, Sharp 2003 paper. | Backbone Marker:Promega; Backbone Size:4045; Vector Backbone:pRL-TK; Vector Types:Luciferase; Bacterial Resistance:Ampicillin | 2022-04-22 03:18:13 | 1 | ||
|
FLAG-Foxo1(pCMV5) Resource Report Resource Website 1+ mentions |
RRID:Addgene_12148 | Foxo1 | Mus musculus | Ampicillin | PMID:16154098 | Note that a BLAST search with Addgene's quality control sequence shows a K219R mutation. The Accili lab has explained that this is a common variant and they do not consider it a mutation at all. They have used the plasmid routinely without issue. The plasmid also contains an L619P polymorphism. | Backbone Size:4700; Vector Backbone:pCMV5; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-08-31 01:00:50 | 1 | |
|
pET28a(+) 6xHis-3xFlag-IFIT5 Resource Report Resource Website 1+ mentions |
RRID:Addgene_53561 | IFIT5 | Homo sapiens | Kanamycin | PMID:23317505 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28a(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2022-09-01 01:03:25 | 1 | ||
|
PKC epsilon DN Resource Report Resource Website 1+ mentions |
RRID:Addgene_21243 | PKC epsilon | Mus musculus | Ampicillin | PMID:12794082 | Backbone Size:5400; Vector Backbone:pHACE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K437R | 2022-09-01 01:02:35 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
