| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pCLXSN-EphA2-Flag Resource Report Resource Website |
RRID:Addgene_102755 | EphA2 | Homo sapiens | Ampicillin | PMID:24607842 | Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:19 | 0 | ||
|
pCLXSN-c-JUN Resource Report Resource Website |
RRID:Addgene_102758 | c-Jun | Homo sapiens | Ampicillin | PMID:24607842 | Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:19 | 0 | ||
|
K761N EPHA3 pcDNA3.1 Resource Report Resource Website |
RRID:Addgene_102752 | EPHA3 | Homo sapiens | Ampicillin | PMID:22829656 | Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K761N (AAG > AAt) | 2022-04-22 03:15:19 | 0 |
|
D806N EPHA3 pcDNA3.1 Resource Report Resource Website |
RRID:Addgene_102754 | EPHA3 | Homo sapiens | Ampicillin | PMID:22829656 | Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | D806N (GAT > aAT) | 2022-04-22 03:15:19 | 0 |
|
EPHA3_1-972 pcDNA3.1 Resource Report Resource Website |
RRID:Addgene_102739 | EPHA3 | Homo sapiens | Ampicillin | PMID:22829656 | Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer. | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:19 | 0 | |
|
PB-GG-OMKSL-PGK-Puro Resource Report Resource Website |
RRID:Addgene_102894 | OMKSL-gRNAs-PGK-Puro | Homo sapiens | Ampicillin | PMID:29980666 | Vector Backbone:PB-GG-PGK-puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:22 | 0 | ||
|
PB-EEA-5g-OSK2M2L1-PGK-Puro Resource Report Resource Website |
RRID:Addgene_102909 | EEA-5g-OSK2M2L1-gRNAs-PGK-Puro | Homo sapiens | Ampicillin | PMID:29980666 | Vector Backbone:PB-GG-PGK-puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:22 | 0 | ||
|
pHMR1A Resource Report Resource Website |
RRID:Addgene_102957 | MR1A cDNA | Homo sapiens | Ampicillin | PMID:24832684 | Backbone Marker:Invitrogen; Backbone Size:3908; Vector Backbone:pCR2.1-TOPO; Vector Types:Other, Cloning; Bacterial Resistance:Ampicillin | Stop codon has been removed by HindIII site | 2022-04-22 03:15:23 | 0 | |
|
GESTALT_pX330-v1 Resource Report Resource Website |
RRID:Addgene_103061 | integration of Cas9 with guide targeting GESTALT barcodes V1 to V5 | Homo sapiens | Ampicillin | PMID:27229144 | Derived from pX330-U6-Chimeric_BB-CBh-hSpCas9 | Vector Backbone:lentiCRISPR v2 (#52961); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:25 | 0 | |
|
pAAV-synp-F-H2B-GCaMP6f Resource Report Resource Website |
RRID:Addgene_102994 | H2B-GCaMP6f | Homo sapiens | Ampicillin | PMID:29736000 | Backbone Marker:unknown; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 0 | ||
|
pAAV-synp-F-synaptophysin-GCaMP6f Resource Report Resource Website |
RRID:Addgene_102996 | Synaptophysin-GCaMP6f | Homo sapiens | Ampicillin | PMID: | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 0 | ||
|
LSB-hsa-miR-125b-5p Resource Report Resource Website |
RRID:Addgene_103191 | hsa-miR-125b-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-let-7f-5p Resource Report Resource Website |
RRID:Addgene_103156 | hsa-let-7f-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-miR-101-3p Resource Report Resource Website |
RRID:Addgene_103165 | hsa-miR-101-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-miR-105-3p Resource Report Resource Website |
RRID:Addgene_103169 | hsa-miR-105-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-let-7a-5p Resource Report Resource Website |
RRID:Addgene_103146 | hsa-let-7a-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
pET28b-hTIG3-1-164 Resource Report Resource Website |
RRID:Addgene_100724 | RARRES3 | Homo sapiens | Kanamycin | PMID:20100577 | Backbone Marker:Novagen; Backbone Size:5200; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:14:55 | 0 | ||
|
YCe1897 HC_Kan_C-KDEL_8a Resource Report Resource Website |
RRID:Addgene_100681 | C-KDEL | Homo sapiens | Kanamycin | PMID:28418644 | KDEL sequence at C terminal of the coding sequence cloned in position 7. | Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2022-04-22 03:14:54 | 0 | |
|
pHis-hPim1 Resource Report Resource Website |
RRID:Addgene_100722 | Pim1 | Homo sapiens | Kanamycin | PMID:23936194 | Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Residues 29-313 of isoform 2 | 2022-04-22 03:14:55 | 0 | |
|
pHis-hMTMR1 Resource Report Resource Website |
RRID:Addgene_100723 | MTMR1 | Homo sapiens | Kanamycin | PMID:27018598 | The MTMR1 construct is for structural determination and contains the PH-GRAM and PTPase domains (amino acids 95-607). PTPase activity was confirmed. | Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Contains amino acids 95-607 | 2022-04-22 03:14:55 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.