Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:bleocin (zeocin) (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

560 Results - per page

Show More Columns | Download 560 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pFUSEss-CHIg-mG3_M18
 
Resource Report
Resource Website
RRID:Addgene_82356 mouse immunoglobulin heavy chain IgG3 isotype Mus musculus Bleocin (Zeocin) PMID:27484487 Backbone Marker:Invivogen; Backbone Size:4501; Vector Backbone:pFUSEss-CHIg-mG3; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) none 2023-03-31 01:08:43 0
pFUSEss-CHIg-mG1_M18
 
Resource Report
Resource Website
RRID:Addgene_82357 mouse immunoglobulin heavy chain IgG1 isotype Mus musculus Bleocin (Zeocin) PMID:27484487 Backbone Marker:Invivogen; Backbone Size:4492; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) none 2023-03-31 01:08:43 0
pFUSEss-chimeric-IgM-mouse/human_M18
 
Resource Report
Resource Website
RRID:Addgene_91738 immunoglobulin heavy constant mu Mus musculus Bleocin (Zeocin) PMID:29323348 Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Residues 203-239 (EU numbering) were exchanged to human homologue sequence. 2023-03-31 01:09:13 0
pBoPyV2a-S22
 
Resource Report
Resource Website
RRID:Addgene_62356 Full genome of BoPyV2a isolate S22 Other Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with SacII Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:07:52 0
pFUSEss-CHIg-mM-Arg210Ala_M18
 
Resource Report
Resource Website
RRID:Addgene_91734 immunoglobulin heavy constant mu Mus musculus Bleocin (Zeocin) PMID:29323348 Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Arg210 changed to Ala (EU numbering) 2023-03-31 01:09:13 0
pFUSEss-CHIg-mM-Asp212Ala_M18
 
Resource Report
Resource Website
RRID:Addgene_91735 immunoglobulin heavy constant mu Mus musculus Bleocin (Zeocin) PMID:29323348 Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Asp212 changed to Ala (EU numbering) 2023-03-31 01:09:13 0
pFUSEss-CHIg-mM-Lys208Ala_M18
 
Resource Report
Resource Website
RRID:Addgene_91732 immunoglobulin heavy constant mu Mus musculus Bleocin (Zeocin) PMID:29323348 Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) Lys208 changed to Ala (EU numbering) 2023-03-31 01:09:13 0
pFUSEss-CHIg-mM-His204Ala_M18
 
Resource Report
Resource Website
RRID:Addgene_91730 immunoglobulin heavy constant mu Mus musculus Bleocin (Zeocin) PMID:29323348 Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) His204 changed to Ala (EU numbering) 2023-03-31 01:09:13 0
pBoPyV3-S22
 
Resource Report
Resource Website
RRID:Addgene_62368 Full genome of BoPyV3 isolate S22 Other Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with EcoRI Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:07:52 0
pBoPyV3-S23
 
Resource Report
Resource Website
RRID:Addgene_62369 Full genome of BoPyV3 isolate S23 Other Bleocin (Zeocin) PMID:25568187 Genome can be liberated by digestion with EcoRI Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:07:52 0
pIZ-Flag6His-BmAgo3
 
Resource Report
Resource Website
RRID:Addgene_50559 BmAgo3 Other Bleocin (Zeocin) PMID:19460866 Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:07:19 0
ph2p
 
Resource Report
Resource Website
RRID:Addgene_22520 MPyV VP2 Murine Polyomavirus Bleocin (Zeocin) PMID:19750217 First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm Backbone Size:3973; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:05:56 0
SuExp His-Myc-hPLD4
 
Resource Report
Resource Website
RRID:Addgene_173852 PLD4 Homo sapiens Bleocin (Zeocin) PMID:34620855 Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) intracellular and transmembrane domain truncated, with only extracellular domain 2023-03-31 01:04:35 0
SuExp His-Myc-hPLD3
 
Resource Report
Resource Website
RRID:Addgene_173851 PLD3 Homo sapiens Bleocin (Zeocin) PMID:34620855 Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) intracellular and transmembrane domain truncated, with only extracellular domain 2023-03-31 01:04:35 0
p8RwB
 
Resource Report
Resource Website
RRID:Addgene_48733 dsRed-Express Other Bleocin (Zeocin) PMID:17603495 This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:07:13 0
pCAG-p21_S146A
 
Resource Report
Resource Website
RRID:Addgene_40205 p21 Homo sapiens Bleocin (Zeocin) PMID:23299246 Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) S146A 2023-03-31 01:06:45 0
pCAG-p21_T145A/S146A
 
Resource Report
Resource Website
RRID:Addgene_42623 p21 Homo sapiens Bleocin (Zeocin) PMID:23299246 Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) T145A/S146A 2023-03-31 01:06:52 0
pwM
 
Resource Report
Resource Website
RRID:Addgene_22515 MCPyV VP1 Merkel Cell Polyomavirus Bleocin (Zeocin) PMID:19750217 First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) codon modified gene 2023-03-31 01:05:56 0
pMODloxZeo3DAmp
 
Resource Report
Resource Website
RRID:Addgene_27182 lox-EM7p-Zeo-lox cassette flanked by Tn5 outer element synthetic Bleocin (Zeocin) PMID:15784610 Note that Bleomycin and Zeocin are the same antibiotic. Backbone Marker:Epicentre; Backbone Size:2000; Vector Backbone:pMOD; Vector Types:Other, in vitro transposion; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:06:11 0
M-tdTom-SP
 
Resource Report
Resource Website
RRID:Addgene_48677 TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 Synthetic Bleocin (Zeocin) PMID:24076762 Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) 2023-03-31 01:07:13 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.