Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 6 showing 101 ~ 120 out of 61,368 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection
  • RRID:Addgene_102755

http://www.addgene.org/102755

Species: Homo sapiens
Genetic Insert: EphA2
Vector Backbone Description: Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102755 Copy   


  • RRID:Addgene_102758

http://www.addgene.org/102758

Species: Homo sapiens
Genetic Insert: c-Jun
Vector Backbone Description: Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102758 Copy   


  • RRID:Addgene_102752

http://www.addgene.org/102752

Species: Homo sapiens
Genetic Insert: EPHA3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer.

Proper citation: RRID:Addgene_102752 Copy   


  • RRID:Addgene_102754

http://www.addgene.org/102754

Species: Homo sapiens
Genetic Insert: EPHA3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer.

Proper citation: RRID:Addgene_102754 Copy   


  • RRID:Addgene_102739

http://www.addgene.org/102739

Species: Homo sapiens
Genetic Insert: EPHA3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer.

Proper citation: RRID:Addgene_102739 Copy   


  • RRID:Addgene_102894

http://www.addgene.org/102894

Species: Homo sapiens
Genetic Insert: OMKSL-gRNAs-PGK-Puro
Vector Backbone Description: Vector Backbone:PB-GG-PGK-puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102894 Copy   


http://www.addgene.org/102909

Species: Homo sapiens
Genetic Insert: EEA-5g-OSK2M2L1-gRNAs-PGK-Puro
Vector Backbone Description: Vector Backbone:PB-GG-PGK-puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102909 Copy   


  • RRID:Addgene_102957

http://www.addgene.org/102957

Species: Homo sapiens
Genetic Insert: MR1A cDNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3908; Vector Backbone:pCR2.1-TOPO; Vector Types:Other, Cloning; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102957 Copy   


  • RRID:Addgene_103061

http://www.addgene.org/103061

Species: Homo sapiens
Genetic Insert: integration of Cas9 with guide targeting GESTALT barcodes V1 to V5
Vector Backbone Description: Vector Backbone:lentiCRISPR v2 (#52961); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Derived from pX330-U6-Chimeric_BB-CBh-hSpCas9

Proper citation: RRID:Addgene_103061 Copy   


http://www.addgene.org/102994

Species: Homo sapiens
Genetic Insert: H2B-GCaMP6f
Vector Backbone Description: Backbone Marker:unknown; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102994 Copy   


http://www.addgene.org/102996

Species: Homo sapiens
Genetic Insert: Synaptophysin-GCaMP6f
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102996 Copy   


  • RRID:Addgene_103191

http://www.addgene.org/103191

Species: Homo sapiens
Genetic Insert: hsa-miR-125b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103191 Copy   


  • RRID:Addgene_103156

http://www.addgene.org/103156

Species: Homo sapiens
Genetic Insert: hsa-let-7f-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103156 Copy   


  • RRID:Addgene_103165

http://www.addgene.org/103165

Species: Homo sapiens
Genetic Insert: hsa-miR-101-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103165 Copy   


  • RRID:Addgene_103169

http://www.addgene.org/103169

Species: Homo sapiens
Genetic Insert: hsa-miR-105-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103169 Copy   


  • RRID:Addgene_103146

http://www.addgene.org/103146

Species: Homo sapiens
Genetic Insert: hsa-let-7a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103146 Copy   


  • RRID:Addgene_100724

http://www.addgene.org/100724

Species: Homo sapiens
Genetic Insert: RARRES3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5200; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_100724 Copy   


http://www.addgene.org/100681

Species: Homo sapiens
Genetic Insert: C-KDEL
Vector Backbone Description: Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
References:
Comments: KDEL sequence at C terminal of the coding sequence cloned in position 7.

Proper citation: RRID:Addgene_100681 Copy   


  • RRID:Addgene_100722

http://www.addgene.org/100722

Species: Homo sapiens
Genetic Insert: Pim1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:

Proper citation: RRID:Addgene_100722 Copy   


  • RRID:Addgene_100723

http://www.addgene.org/100723

Species: Homo sapiens
Genetic Insert: MTMR1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: The MTMR1 construct is for structural determination and contains the PH-GRAM and PTPase domains (amino acids 95-607). PTPase activity was confirmed.

Proper citation: RRID:Addgene_100723 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X