Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Organism:drosophila melanogaster (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

443,750 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
pGEX-6P-2_dCrk
 
Resource Report
Resource Website 		RRID:Addgene_131146 Crk Drosophila melanogaster Ampicillin PMID:31318326 Backbone Marker:GE Healthcare Life Sciences; Backbone Size:4985; Vector Backbone:pGEX-6P-2; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:24:04 0
pTIGER_mNeonGreen::3xFLAG::dCrk
 
Resource Report
Resource Website 		RRID:Addgene_131137 Crk Drosophila melanogaster Ampicillin PMID:31318326 Backbone Size:10240; Vector Backbone:pTIGER; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:24:04 0
KHBD00596
 
Resource Report
Resource Website 		RRID:Addgene_39677 CG6061 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Other, Gateway DONR vector; Bacterial Resistance:Kanamycin 2022-05-27 01:15:38 0
pGEX-2T-CBP(1-287)
 
Resource Report
Resource Website 		RRID:Addgene_182839 CBP1-287 Drosophila melanogaster Ampicillin PMID:24550119 Backbone Marker:Novagen; Backbone Size:4900; Vector Backbone:pGEX-2T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-06-11 01:15:39 0
pTL472
 
Resource Report
Resource Website 		RRID:Addgene_69882 CIRL Drosophila melanogaster Ampicillin PMID:25937282 Vector Backbone:pTL412; Vector Types:Other, transformation vector; Bacterial Resistance:Ampicillin 2022-06-26 01:03:52 0
pTL464
 
Resource Report
Resource Website 		RRID:Addgene_69881 CIRL Drosophila melanogaster Ampicillin PMID:25937282 Backbone Marker:Huang et al., 2009, PMID 19429710; Vector Backbone:pGE-attB-GMR; Vector Types:Other, phiC31-integration vector; Bacterial Resistance:Ampicillin 2022-06-26 01:03:52 0
pBacPak-HA-E(y)2
 
Resource Report
Resource Website 		RRID:Addgene_52288 E(y)2 Drosophila melanogaster Ampicillin PMID:24493646 Vector Backbone:pBacPak; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-07-27 01:03:12 0
pDonor_N_FH_GLE
 
Resource Report
Resource Website 		RRID:Addgene_186657 OSS Gle N-terminal 3xFlag-3xHA Tag Donor Plasmid Drosophila melanogaster Ampicillin PMID:35639929 Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-07-23 01:02:25 0
Nbr_C_sgRNA2
 
Resource Report
Resource Website 		RRID:Addgene_186664 Nbr sgRNA 2 Plasmid Drosophila melanogaster Ampicillin PMID:35639929 sgRNA sequence: AGCTCCTCAATCACTTAACA. The corresponding genome sequence is: AGCTCCTCAATCACTTAACA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-07-24 01:02:31 0
Shu_sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_186656 Shu sgRNA Plasmid Drosophila melanogaster Ampicillin PMID:35639929 sgRNA sequence: GATAGCTTTAGCGAATCGAT. The corresponding genome sequence is: GATAGCTTTAGCGAATCGAT. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-07-24 01:02:30 0
piwi_sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_186653 Piwi sgRNA Plasmid Drosophila melanogaster Ampicillin PMID:35639929 sgRNA sequenceGCGAGTGCCAAAAAGTAACAA, The corresponding genome sequence is: GCGAGTGCCAAAAAGTAACA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-08-12 01:02:28 0
Donor_N_FH_Shu
 
Resource Report
Resource Website 		RRID:Addgene_186655 OSS Shu N-terminal 3xFlag-3xHA Tag Donor Plasmid Drosophila melanogaster Ampicillin PMID:35639929 Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pUC19; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-08-13 01:02:28 0
GLE_sgRNA
 
Resource Report
Resource Website 		RRID:Addgene_186658 Gle sgRNA Plasmid Drosophila melanogaster Ampicillin PMID:35639929 sgRNA sequence: GCGTATCCCCTTAACAATAA. The corresponding genome sequence is: CCGTATCCCCTTAACAATAA. Please visit https://www.biorxiv.org/content/10.1101/2020.12.18.423517v1 for bioRxiv preprint. Vector Backbone:pU6-BbsI-chiRNA; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-08-13 01:02:28 0
KHBD00309
 
Resource Report
Resource Website 		RRID:Addgene_34434 CG12029 Drosophila melanogaster Kanamycin PMID:22037703 Please note that the ORFs in this collection were cloned open-ended (without a stop codon). Backbone Marker:Invitrogen; Backbone Size:2536; Vector Backbone:pDONR221; Vector Types:Other, Gateway Donor Vector; Bacterial Resistance:Kanamycin 2022-08-19 01:02:55 0
RCAS(A) dRhoA N19 (CT#847)
 
Resource Report
Resource Website 		RRID:Addgene_14002 RhoA Drosophila melanogaster Ampicillin PMID:11239392 Backbone Size:11600; Vector Backbone:RCASBP(A); Vector Types:Retroviral, Other, avian expression; Bacterial Resistance:Ampicillin T19N 2022-04-22 03:26:44 0
Beta Nu
 
Resource Report
Resource Website 		RRID:Addgene_14069 Drosphila Beta Nu Integrin Drosophila melanogaster Ampicillin PMID:8076521 Backbone Size:3000; Vector Backbone:PBluescript II SK-; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:26:52 0
K20‐scFv‐pSMBP2
 
Resource Report
Resource Website 		RRID:Addgene_159940 anti beta-1 integrin scFv Drosophila melanogaster Ampicillin PMID:32613646 Backbone Size:4800; Vector Backbone:pSMBP2; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:29:53 0
DmTmem63
 
Resource Report
Resource Website 		RRID:Addgene_136598 DmTMEM63 Drosophila melanogaster Kanamycin PMID:30382938 Backbone Size:5286; Vector Backbone:pIRES2-mCherry; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin 2022-04-22 03:25:39 0
RCAS(A) dRhoA V14 (CT#846)
 
Resource Report
Resource Website 		RRID:Addgene_13949 RhoA Drosophila melanogaster Ampicillin PMID:11239392 Backbone Size:11600; Vector Backbone:RCASBP(A); Vector Types:Retroviral, Other, avian expression; Bacterial Resistance:Ampicillin G14V mutation 2022-04-22 03:26:38 0
pMT-Hrp48-ADARcd-E488Q-V5
 
Resource Report
Resource Website 		RRID:Addgene_139685 Hrp48, ADAR Drosophila melanogaster Ampicillin PMID:29127211 Vector Backbone:pMT; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin 2022-04-22 03:26:40 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.

Recent News Entries

New Release: NeuroMorpho.Org Version 8.6 (12/4/23), with 14,452 new tracings from 45 datasets

Dr. Martone on BrainFacts.org a FAIR video

With 2023 there are new NIH guidelines on data deposition, are you ready?

Contact Us

FAIR Data Informatics Lab

University of California, San Diego
9500 Gilman Drive, Mail Code 0608
La Jolla, CA 92093-0608
United States

info  scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch