Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pPICZ-pre-pro-alphaf(I)-E2-Crimson Resource Report Resource Website |
RRID:Addgene_117660 | pre-pro-alphaf(I)-E2-Crimson | Other | Bleocin (Zeocin) | PMID:30314480 | Integration plasmid in the pAOX1 locus. | Vector Backbone:pPICZalpha; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | This plasmid encodes the fluorescent protein E2-Crimson together with the mating alpha factor secretion signal from Saccharomyces cerevisiae commonly seen in plasmid from Invitrogen. This secretion signal variant has Ser at position 42 and a trio of point mutations that create an XhoI restriction site while changing Asp83 to Glu in comparison with the native signal sequence. | 2023-03-31 01:01:15 | 0 |
|
pPICZ-pOst1-pro-alphaf(MUT1)-E2-Crimson Resource Report Resource Website |
RRID:Addgene_117662 | pOst1-pro-af(MUT1)-E2-Crimson | Other | Bleocin (Zeocin) | PMID:30314480 | Integration plasmid in the pAOX1 locus. | Vector Backbone:pPICZalpha; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | This plasmid encodes the fluorescent protein E2-Crimson together with an hibrid secretion signal. This secretion signal is composed by the the signal sequence of Ost1 from Saccharomyces cerevisiae and the the native mating alpha factor pro region from Saccharomyces cerevisiae. The pro region has Serine at position 42. | 2023-03-31 01:01:15 | 0 |
|
pPICZ-pre-Ost1-alphaf(I)-E2-Crimson Resource Report Resource Website |
RRID:Addgene_117661 | pre-Ost1-alphaf(I)-E2-Crimson | Other | Bleocin (Zeocin) | PMID:30314480 | Integration plasmid in the pAOX1 locus. | Vector Backbone:pPICZalpha; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | This plasmid encodes the fluorescent protein E2-Crimson together with an hibrid secretion signal. This secretion signal is composed by the the signal sequence of Ost1 from Saccharomyces cerevisiae and the the native mating alpha factor pro region from Saccharomyces cerevisiae. The pro region variant has Ser at position 42 and a trio of point mutations that create an XhoI restriction site while changing Asp83 to Glu in comparison with the native pro sequence. | 2023-03-31 01:01:15 | 0 |
|
pPICZ-pre-Ost1-alphaf(I)-Btl2 Resource Report Resource Website |
RRID:Addgene_117667 | pre-Ost1-alphaf(I)-Btl2 | Other | Bleocin (Zeocin) | PMID:30314480 | Integration plasmid in the pAOX1 locus. | Vector Backbone:pPICZalpha; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | This plasmid encodes the lipase Btl2 together with an hibrid secretion signal. This secretion signal is composed by the the signal sequence of Ost1 from Saccharomyces cerevisiae and the the native mating alpha factor pro region from Saccharomyces cerevisiae. The pro region variant has Ser at position 42 and a trio of point mutations that create an XhoI restriction site while changing Asp83 to Glu in comparison with the native pro sequence. | 2023-03-31 01:01:15 | 0 |
|
DH10B-M.XmnI Resource Report Resource Website |
RRID:Addgene_114269 | Bleocin (Zeocin) | PMID:29986052 | See Supplemental Documents for strain verification protocols and data. | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:01:01 | 0 | |||
|
DH10B-M2.NmeMC58II Resource Report Resource Website |
RRID:Addgene_114268 | Bleocin (Zeocin) | PMID:29986052 | See Supplemental Documents for strain verification protocols and data. | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:01:01 | 0 | |||
|
pFUSEss-CHIg-mG1_Arg322Lys Resource Report Resource Website |
RRID:Addgene_105849 | IgG1 heavy chain | Mus musculus | Bleocin (Zeocin) | PMID:29875771 | Backbone Marker:Invivogen; Backbone Size:4474; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Arg322Lys in constant region of IgG1 heavy chain | 2023-03-31 01:00:29 | 0 | |
|
p221z-erVenusYFP Resource Report Resource Website |
RRID:Addgene_71265 | VenusYFP | Other | Bleocin (Zeocin) | PMID:26644504 | Backbone Marker:Invitrogen; Vector Backbone:pDONR/Zeo; Vector Types:Other, Gateway; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:08:14 | 0 | ||
|
pOP459 Resource Report Resource Website |
RRID:Addgene_85933 | Anti-Ebola 2G4 monoclonal antibody | Homo sapiens | Bleocin (Zeocin) | PMID:28786662 | Vector Backbone:Unknown; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:08:54 | 0 | ||
|
pJK138 Resource Report Resource Website |
RRID:Addgene_73314 | Pas2p (peroxisomal membrane targeting region) | Other | Bleocin (Zeocin) | PMID: | Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | encodes residues 1-42 | 2023-03-31 01:08:19 | 0 | |
|
pJK142 Resource Report Resource Website |
RRID:Addgene_73317 | delta-12 fatty acid acetylenase | Other | Bleocin (Zeocin) | PMID: | Backbone Size:3329; Vector Backbone:pPICZA; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | synthetic gene. Encodes a glycine-204 to serine mutation in the Pas2 fusion domain | 2023-03-31 01:08:20 | 0 | |
|
pFUSEss-CHIg-mM_M18 Resource Report Resource Website |
RRID:Addgene_91729 | immunoglobulin heavy constant mu | Mus musculus | Bleocin (Zeocin) | PMID:29323348 | Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:09:13 | 0 | ||
|
pCoofy42 Resource Report Resource Website |
RRID:Addgene_55190 | Bleocin (Zeocin) | PMID:23410102 | C-terminal tags are separated by stop codons. Depending on the LP2 primer used in SLIC, the desired C-terminal tag(s) can be fused to the target gene. Use the one of the following linearization primers pairs for SLIC cloning. Choose one LP1 forward vector primer and one LP2 reverse vector primer: LP1 forward vector primer: SLIC Primer (3C site) 5' GGGCCCCTGGAACAGAACTTCCAG 3' LP2 - select an LP2 primer below depending on which C-terminal tags you want to include fused to your gene of interest: none SLIC Primer 5' CGCCATTAACCTGATGTTCTGGGG 3' 10His- SLIC Primer 5`GAGCATCATCATCATCACCAC 3' StrepOne - SLIC Primer 5`AGCGCTTGGAGCCACCCGCAG 3' S-Tag - SLIC Primer 5`AAAGAAACCGCTGCTGCTAAATTCG 3' HPC4 - SLIC Primer 5`GAGGACCAGGTGGACCCCCGG 3' Æ54CPD - SLIC Primer 5`GGCAGCGGCAAGATCCTGCAC 3' Test each preparation of the plasmid by transforming it into non-resistant cells (ex. DH5a) to ensure negative selection by ccdB kills all the transformed cells as expected. | Backbone Marker:Life Technologies; Backbone Size:4871; Vector Backbone:pPICZalpha C; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:35 | 0 | |||
|
pRwB Resource Report Resource Website |
RRID:Addgene_48734 | dsRed-Express | Other | Bleocin (Zeocin) | PMID:19073722 | Note that this plasmid is substantially smaller than the ~8kb native papillomavirus genome. There is a second version of this plasmid with a 2kb stuffer region that is available here: http://www.addgene.org/48733 . Further information can be found here: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:13 | 0 | |
|
Strain: C321.ΔA Resource Report Resource Website 1+ mentions |
RRID:Addgene_68306 | None | Bleocin (Zeocin) | PMID:26350500 | Derived from Lajoie, et. al., Genomically recoded organisms expand biological functions, Science, 2013, with the following genomic modifications: ΔmutS:zeo, ΔtolC, Δbla:tolC, SerB-/ΔSerB | Vector Backbone:None; Vector Types:; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:08:07 | 1 | ||
|
pPICZA_CeTRIC-B1_Del Resource Report Resource Website |
RRID:Addgene_87344 | TRIC-B1 | Caenorhabditis elegans | Bleocin (Zeocin) | PMID:27698420 | Vector pPICZ A and insert sequence were modified as follows: 1. Restriction sites including Pml I; Sfi I; BsmB I; Asp718 I; Kpn I were destroyed during cloning full-length CeTRIC-B1 to the vector. 2. In the C-terminal truncation, the sequence between XhoI and polyhistidine had been deleted. That is to say, restriction sites including Xho I, Sac II, Not I, Apa I, and myc-epitope, were destroyed during truncation. 3. A kozak suqence "ACC" was inserted between the restriction site "EcoR I" and initial codon, we added these 3 bp into insert sequence size. In summary, the size of pPICZ A backbone is changed from 3329 bp to be 3221 bp. | Backbone Marker:Invitrogen; Backbone Size:3221; Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | Δ248-297 | 2023-03-31 01:08:59 | 0 |
|
PP363 Resource Report Resource Website |
RRID:Addgene_78984 | rHGH | Bleocin (Zeocin) | PMID:27470089 | Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:08:37 | 0 | |||
|
pBudORF2-CH Resource Report Resource Website |
RRID:Addgene_51289 | L1 ORF2 | Homo sapiens | Bleocin (Zeocin) | PMID:21572950 | This plasmid was created using the codon optimized L1RP as a source for the ORF2 coding sequence. | Backbone Marker:Invitrogen; Backbone Size:4595; Vector Backbone:pBudCE4.1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:21 | 0 | |
|
PP326 Resource Report Resource Website |
RRID:Addgene_78983 | rHGH | Bleocin (Zeocin) | PMID:27470089 | Vector Backbone:pPICZ A; Vector Types:Yeast Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:08:37 | 0 | |||
|
C321.ΔA.exp Resource Report Resource Website 1+ mentions |
RRID:Addgene_49018 | Recoded E. coli with all UAG codons and RF1 removed (UAG termination abolished); decreased mutation rate; 37C growth tolerated | Other | Bleocin (Zeocin) | PMID:24136966 | E. coli MG1655 Delta(ybhB-bioAB)::zeoR Delta prfA; all 321 UAG codons changed to UAA This strain is mutS+, which causes a normal spontaneous mutation frequency of ~1E-10. This strain is auxotrophic for d-biotin. The genome sequence of a similar strain (C321.deltaA) was deposited at NCBI (accession # CP006698.1). | Vector Backbone:E. coli genome; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | See genbank file | 2023-03-31 01:07:14 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
