Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
zbFGF Resource Report Resource Website 1+ mentions |
RRID:Addgene_12309 | Fgf2 | Danio rerio | Kanamycin | PMID:16862139 | Backbone Marker:Novagen; Backbone Size:5369; Vector Backbone:pET28b(+); Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | Ala 11 mutated to Pro, Ser 55 mutated to Asn | 2022-04-22 03:21:20 | 1 | |
|
pORTMAGE311B Resource Report Resource Website 1+ mentions |
RRID:Addgene_120418 | MutL E32K | Synthetic | Kanamycin | PMID: | Please visit the depositor's website: http://group.szbk.u-szeged.hu/sysbiol/pal-csaba-lab-resources.html for additional information. To view a protocol for using this plasmid, please visit http://group.szbk.u-szeged.hu/sysbiol/EvGEn/resources.html Please visit https://www.biorxiv.org/content/10.1101/495630v1 for bioRxiv preprint. | Backbone Marker:The Standard European Vector Architecture (SEVA); http://seva.cnb.csic.es/; Vector Backbone:pSEVA258; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin | E32K mutation conferring dominant mutator phenotype | 2022-04-22 03:20:40 | 1 |
|
pDSW1728 Resource Report Resource Website 1+ mentions |
RRID:Addgene_120812 | red fluorescent protein (mCherry), codon-optimized for C. difficile | Synthetic | Chloramphenicol | PMID:25527559 | Backbone Size:6400; Vector Backbone:pRFP185; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol | 2022-04-22 03:20:45 | 1 | ||
|
pAAV-hsyn_NES-His-rsCaMPARI-mRuby3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_120805 | rsCaMPARI | Synthetic | Ampicillin | PMID:32931424 | Backbone Size:4270; Vector Backbone:pAAV; Vector Types:AAV; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:45 | 1 | ||
|
pET28a-mH6-Cas12i1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_120882 | Cas12i1 | Synthetic | Kanamycin | PMID:30523077 | For more information, please visit us at https://arbor.bio/. For commercial use or questions, please contact us at inquiries@arbor.bio. mH6 sequence: ATGAAAATCGAAGAAGGTAAAGGTCACCATCACCATCACCAC | Backbone Marker:Novagen; Backbone Size:5349; Vector Backbone:pET-28a+; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Kanamycin | WT | 2022-04-22 03:20:46 | 1 |
|
pRK5-HA-Ubiquitin-K11R Resource Report Resource Website 1+ mentions |
RRID:Addgene_121154 | Ubiquitin C | Homo sapiens | Ampicillin | PMID:24671417 | Backbone Marker:Ted Dawson, Addgene plasmid #17608; Vector Backbone:pRK5-HA; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | K11 mutated to an R | 2022-04-22 03:20:50 | 1 | |
|
Green Glifon50 Resource Report Resource Website 1+ mentions |
RRID:Addgene_126206 | Green Glifon50 | Ampicillin | PMID:30869867 | Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:22:20 | 1 | |||
|
Green Glifon4000 Resource Report Resource Website 1+ mentions |
RRID:Addgene_126208 | Green Glifon4000 | Ampicillin | PMID:30869867 | Backbone Size:5400; Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:22:20 | 1 | |||
|
BRCA1 (1-304) Resource Report Resource Website 1+ mentions |
RRID:Addgene_12645 | E3-Ring domain, Ub-ligase | Homo sapiens | Ampicillin | PMID:16543155 | Backbone Marker:invitrogen; Backbone Size:4500; Vector Backbone:pET151D topo; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:22:25 | 1 | ||
|
Ubiquitin WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_12647 | Ubiquitin - wild type | Homo sapiens | Ampicillin | PMID:16543155 | This plasmid contains a 76 amino acid synthetic ubiquitin insert used to determine the 3D structure of the UbcH5c/Ub noncovalent complex, as described in the associated publication. | Backbone Marker:Novagen; Backbone Size:5000; Vector Backbone:pET15; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:22:26 | 1 | |
|
DsRed-rab11 WT Resource Report Resource Website 1+ mentions |
RRID:Addgene_12679 | RAB11A (Homo sapiens) | Homo sapiens | Kanamycin | PMID:12070301 | Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pDsRed-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2022-04-22 03:22:31 | 3 | ||
|
pAtU6-sgRNA Resource Report Resource Website 1+ mentions |
RRID:Addgene_119775 | AtU6-SmR-sgRNA | Other | Ampicillin | PMID:30272679 | Backbone Size:3152; Vector Backbone:pUC57; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:20:23 | 1 | ||
|
A3A-PBE Resource Report Resource Website 1+ mentions |
RRID:Addgene_119768 | APOBEC3A-nCas9-NLS-UGI-NLS | Other | Ampicillin | PMID:30272679 | Backbone Size:4919; Vector Backbone:pJIT163; Vector Types:Plant Expression; Bacterial Resistance:Ampicillin | nCas9 has a mutation D10A and E945K in wild type SpCas9 | 2022-04-22 03:20:22 | 2 | |
|
p3xFLAG-MKL1 Resource Report Resource Website 1+ mentions |
RRID:Addgene_11978 | MKL1 | Homo sapiens | Ampicillin | PMID:12944485 | Backbone Marker:Sigma; Backbone Size:4700; Vector Backbone:pCMV-3xFLAG-7.1; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | N579S T716A | 2022-04-22 03:20:23 | 1 | |
|
mCh-BICD2*-strep Resource Report Resource Website 1+ mentions |
RRID:Addgene_120168 | BICD cargo adaptor 2 | Mus musculus | Kanamycin | PMID:31100061 | Backbone Marker:Clontech; Backbone Size:4713; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | Truncated BICD2: 15-595 aa | 2022-04-22 03:20:33 | 1 | |
|
cacnb2a (rat) in pMT2 vector Resource Report Resource Website 1+ mentions |
RRID:Addgene_107424 | calcium channel beta2a auxillary subunit | Rattus norvegicus | Ampicillin | PMID:9705988 | We received it in pBluescript and subcloned it into pMT2 plasmid. | Backbone Size:5163; Vector Backbone:pMT2; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-09-21 01:00:21 | 1 | |
|
vGAT-pH pcaggs SE Resource Report Resource Website 1+ mentions |
RRID:Addgene_78578 | vGAT-pHluorin C-term | Rattus norvegicus | Ampicillin | PMID:23804087 | Backbone Size:4790; Vector Backbone:pCAGGS E/S; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-09-21 01:04:32 | 1 | ||
|
Gal4-VP16 Resource Report Resource Website 1+ mentions |
RRID:Addgene_71728 | Gal4 DBD(1-147) | Saccharomyces cerevisiae | Ampicillin | PMID:25963659 | Backbone Size:2924; Vector Backbone:pECE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-09-21 01:04:17 | 2 | ||
|
PJ-INPP5E Resource Report Resource Website 1+ mentions |
RRID:Addgene_38001 | FKBP1A | Homo sapiens | Kanamycin | PMID:22722250 | Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information. | Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2022-09-21 01:03:15 | 1 | |
|
PJ-Sac Resource Report Resource Website 1+ mentions |
RRID:Addgene_38000 | FKBP1A | Homo sapiens | Kanamycin | PMID:22722250 | Compared to GenBank reference sequence NM_019892, the INPP5E insert in this plasmid contains a C641A mutation. Please see the full plasmid sequence for the most accurate information. | Backbone Size:4700; Vector Backbone:pmRFP-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin | 2022-09-21 01:03:15 | 1 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
