Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBAMD1-4 Resource Report Resource Website |
RRID:Addgene_61565 | Streptomycin | PMID:25389526 | Backbone Size:4730; Vector Backbone:pBAMD1-4; Vector Types:Synthetic Biology, Other, Mini-Tn5 vector; Bacterial Resistance:Streptomycin | 2022-04-22 03:45:26 | 0 | ||||
|
pAN-PA1-RFP Resource Report Resource Website |
RRID:Addgene_62247 | mRFP | Other | Streptomycin | PMID:25422271 | Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:45:40 | 0 | ||
|
pAN-PA2-RFP Resource Report Resource Website |
RRID:Addgene_62248 | mRFP | Other | Streptomycin | PMID:25422271 | Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:45:40 | 0 | ||
|
pAN-PA4-RFP Resource Report Resource Website |
RRID:Addgene_62250 | mRFP | Other | Streptomycin | PMID:25422271 | Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:45:40 | 0 | ||
|
pAN-PA5-RFP Resource Report Resource Website |
RRID:Addgene_62251 | mRFP | Other | Streptomycin | PMID:25422271 | Vector Backbone:unknown; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:45:40 | 0 | ||
|
pCDF-casBCDE(-6) Resource Report Resource Website |
RRID:Addgene_89730 | CRISPR array | Other | Streptomycin | PMID:27738137 | Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | Derivative CRISPR array containing a shorter version of the wt spacer (-6) truncated by 6 nucleotides at the leader-distal end. | 2022-04-22 03:52:57 | 0 | |
|
pCDF-casBCDE(-18) Resource Report Resource Website |
RRID:Addgene_89732 | CRISPR array | Other | Streptomycin | PMID:27738137 | Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | Derivative CRISPR array containing a shorter version of the wt spacer (-18) truncated by 18 nucleotides at the leader-distal end. | 2022-04-22 03:52:57 | 0 | |
|
pCDF-casBCDE(-12) Resource Report Resource Website |
RRID:Addgene_89731 | CRISPR array | Other | Streptomycin | PMID:27738137 | Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | Derivative CRISPR array containing a shorter version of the wt spacer (-12) truncated by 12 nucleotides at the leader-distal end. | 2022-04-22 03:52:57 | 0 | |
|
pCDF-casBCDE(g8) Resource Report Resource Website |
RRID:Addgene_89727 | CRISPR array | Other | Streptomycin | PMID:27738137 | Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2022-04-22 03:52:57 | 0 | ||
|
pCDF-casBCDE(-3) Resource Report Resource Website |
RRID:Addgene_89729 | CRISPR array | Other | Streptomycin | PMID:27738137 | Backbone Marker:PMID:26013814; Vector Backbone:pCDF-casBCDE; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | Derivative CRISPR array containing a shorter version of the wt spacer (-3) truncated by 3 nucleotides at the leader-distal end. | 2022-04-22 03:52:57 | 0 | |
|
DHL708 Resource Report Resource Website |
RRID:Addgene_98417 | Genotype: MC4100 ∆clpPX | Streptomycin | PMID:27732583 | Strain DHL708 was built by deleting the clpPX operon with lambda-Red mediated homologous recombination. The FRT-flanked Kan cassette was then flipped out using the FLP recombinase (pCP20). The deletion region can be PCR-amplified and sequenced using the primers CCGCTCGAGTTTACGCAGCATAACGCGCTAAATTC and CGTCAGTATATGGGGATGTTTCCCC. Originally described in Landgraf, D., Okumus, B., Chien, P., Baker, T. A. & Paulsson, J. Segregation of molecules at cell division reveals native protein localization. Nat Methods 9, 480–482 (2012). | Vector Backbone:none; Vector Types:; Bacterial Resistance:Streptomycin | 2022-04-22 03:54:05 | 0 | ||
|
pOxyR_rfp Resource Report Resource Website |
RRID:Addgene_194155 | transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein mCherry | Other | Streptomycin | PMID:34820092 | Backbone Marker:https://seva-plasmids.com/; Backbone Size:2754; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2023-02-10 12:04:44 | 0 | ||
|
pCDFBB-eGFP Resource Report Resource Website |
RRID:Addgene_32550 | egfp | Streptomycin | PMID:22033566 | Backbone Marker:Schmidt-Dannert Lab; Backbone Size:2220; Vector Backbone:pCDFBB; Vector Types:Synthetic Biology; Bacterial Resistance:Streptomycin | 2023-09-15 01:10:32 | 0 | |||
|
pPROBE-OT Resource Report Resource Website |
RRID:Addgene_37820 | Promotorless gfp reporter gene | bacteria | Streptomycin | PMID:11059491 | Please refer to the attached table for a complete list of restriction sites in the MCS. | Vector Backbone:pBBR1; Vector Types:; Bacterial Resistance:Streptomycin | 2023-09-15 01:10:51 | 0 | |
|
pTDpelB-C_sfYFPTwinStrep Resource Report Resource Website |
RRID:Addgene_45944 | synthetic sfYFP (codon usage adapted to P.putida KT2440) | Aequorea victoria | Streptomycin | PMID:23687945 | This plasmid was tested in the Gram-negative soil bacterium Pseudomonas putida KT2440 and Escherichia coli K12 and is especially suited for protein production, affinity purification, protein complex copurification with SPINE (Strep Protein Interaction Experiments) or (co-)localization studies. Due to the broad host range of the RK2 origin of replication, the plasmid facilitates experimental verification of hypothetical proteins and protein production yield assessment in different expression hosts possibly including new isolates. The Supplementary Table S1 in the following publication lists approximately 30 strains in which the RK2 origin of replication should be functional. Silva-Rocha et al., The Standard European Vector Architecture (SEVA): a coherent platform for the analysis and deployment of complex prokaryotic phenotypes. Nucleic Acids Research 2013, 41:D666-675. http://nar.oxfordjournals.org/content/41/D1/D666.long | Backbone Marker:Dammeyer et al. 2013; Vector Backbone:pTDpelB-CTwinStrep; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2023-09-15 01:11:15 | 0 | |
|
pCDF-GFPplus Resource Report Resource Website |
RRID:Addgene_172718 | GFP plus | Synthetic | Streptomycin | PMID:34471126 | Please visit https://www.biorxiv.org/content/10.1101/2020.09.02.279141v1 for bioRxiv preprint. | Backbone Size:3725; Vector Backbone:pCDF; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2023-09-15 01:06:38 | 0 | |
|
pYI001 Resource Report Resource Website |
RRID:Addgene_170833 | GUSPlus::tOCS | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2023-09-15 01:06:24 | 0 | ||
|
pYI006 Resource Report Resource Website |
RRID:Addgene_170840 | FRO6p::GUSPlus::tOCS | Streptomycin | PMID:36216814 | Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint. | Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin | 2023-09-15 01:06:24 | 0 | ||
|
pOxyR_gfp Resource Report Resource Website |
RRID:Addgene_194154 | transcriptional regulator, OxyR, cognate promoter PoxyS, fluorescent protein sfGFP | Other | Streptomycin | PMID:34820092 | Backbone Marker:https://seva-plasmids.com/; Backbone Size:2390; Vector Backbone:pSEVA-based; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2023-09-15 01:09:29 | 0 | ||
|
pAN4036 Resource Report Resource Website |
RRID:Addgene_74698 | PPhlF-PBetI-YFP | Other | Streptomycin | PMID:27034378 | Backbone Marker:Alec Nielsen; Backbone Size:3359; Vector Backbone:pAN4020; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin | 2023-09-15 01:14:04 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
