Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDEST-pSP172BSSPE-pFOGc::RfA Resource Report Resource Website |
RRID:Addgene_186397 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. Backbone was modified by insertion of tag at SwaI restriction site | Backbone Marker:PMID: 17878951; Backbone Size:4650; Vector Backbone:pDEST-pSP172BSSPE-Swa1::RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-pSP172BSSPE-Swa1::RfA Resource Report Resource Website |
RRID:Addgene_186396 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. The electroporation vector pSP72-1.27 was modified to give rise to pSP72BSSPE by replacing the NLS-LacZ reporter gene, cloned between BamH1 and EcoR1 by a BamH1-Swa1-Stu1-Pme1-EcoRV-EcoR1 polylinker (GGATCCATTTAAATAGGCCTTTGTTTAAACTTAGATATCGGAATTC). | Backbone Marker:PMID: 9043074; Backbone Size:4650; Vector Backbone:Ascidian electroporation vector pSP72-1.27; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:27 | 0 | |||
|
pDEST-Spe4-RfA-Snaptag-stop Resource Report Resource Website |
RRID:Addgene_186395 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal Snap-tag tag at EcoR V/Avr II restriction site | Backbone Size:5412; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:29 | 0 | |||
|
pDEST-pSP172BSSPE-pFOGc::venus-RfA Resource Report Resource Website |
RRID:Addgene_186400 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for electroporation experiments. Backbone was modified by insertion of N terminal Venus tag at SwaI restriction site | Backbone Marker:PMID: 17878951; Backbone Size:5385; Vector Backbone:pDEST-pSP172BSSPE-Swa1::venus-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:28 | 0 | |||
|
pDEST-Spe4-Kozak-mCherry-RfA Resource Report Resource Website |
RRID:Addgene_186378 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mCherry tag at Bgl II/Stu I restriction site | Backbone Size:5589; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:30 | 0 | |||
|
pDEST-Spe4-RfA Resource Report Resource Website |
RRID:Addgene_186375 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. This plasmid was obtained by gene synthesis from pDEST-Spe3-RfA by addition of a BglII-ZraI-AatII-StuI-SnaBI (agatctgacgtcaggccttacgta) polylinker before the attR1 sequence and an EcoRV-SacII-AfeI-BstEII-AvrII (gatatcgcggccgcggaagcgctggttacctagg) polylinker after the attR2 sequence. | Backbone Marker:PMID: 17878951; Backbone Size:4888; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:29 | 0 | |||
|
pDEST-Spe3-RfA-HA Resource Report Resource Website |
RRID:Addgene_186374 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal HA tag at EcoR V restriction site | Backbone Marker:PMID: 17878951; Backbone Size:4915; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-Spe3-HA-RfA Resource Report Resource Website |
RRID:Addgene_186373 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal HA tag at Stu I restriction site | Backbone Marker:PMID: 17878951; Backbone Size:4926; Vector Backbone:pDEST-Spe3-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-periHisMBP Resource Report Resource Website |
RRID:Addgene_11086 | Chloramphenicol and Ampicillin | PMID:16322578 | The MBP ORF can be sequenced using 5'-GAG CGG ATA ACA ATT TCA CAC AGG-3' as a tac promoter sequencing primer (in the forward direction). To sequence inserts fused to the C-terminus of MBP, the primers are 5'-GAT GAA GCC CTG AAA GAC GCG CAG-3' (forward) and 5'-GCA AGG CGA TTA AGT TGG GTA ACG C-3' (reverse). | Backbone Marker:New England Biolabs; Backbone Size:6000; Vector Backbone:pMal-C2; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:17:32 | 0 | |||
|
pUC57-R1R4 Resource Report Resource Website |
RRID:Addgene_105110 | Chloramphenicol and Ampicillin | PMID:23066669 | Vector Backbone:pUC57-R1R4; Vector Types:Other, Other; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:15:54 | 0 | ||||
|
pXN21-Dest Resource Report Resource Website |
RRID:Addgene_105086 | Chloramphenicol and Ampicillin | PMID:18428659 | Vector Backbone:pXN21-Dest; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:15:54 | 0 | ||||
|
pDEST-actc1b-mKate2-ccdb Resource Report Resource Website |
RRID:Addgene_109732 | Chloramphenicol and Ampicillin | PMID:32709891 | Vector Backbone:pDEST-Tol2-pA2; Vector Types:Other, Zebrafish plasmids; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:17:09 | 0 | ||||
|
pBXNPH3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110098 | Chloramphenicol and Ampicillin | PMID:29792401 | Vector Backbone:pBXNPH3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:17:17 | 1 | ||||
|
pBXNPHM3 Resource Report Resource Website 1+ mentions |
RRID:Addgene_110099 | Chloramphenicol and Ampicillin | PMID:29792401 | Vector Backbone:pBXNPHM3; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:17:17 | 1 | ||||
|
pFRT-TO-DEST Resource Report Resource Website |
RRID:Addgene_106348 | Chloramphenicol and Ampicillin | PMID:28297718 | Vector Backbone:pFRT-EGFP-DEST; Vector Types:Mammalian Expression, Other, Gateway entry vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:16:16 | 0 | ||||
|
Cas9 gateway compatible Resource Report Resource Website |
RRID:Addgene_128321 | Chloramphenicol and Ampicillin | PMID: | Backbone Size:11000; Vector Backbone:pcDNA3.3-TOPO; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:23:15 | 0 | ||||
|
pGAN147 Resource Report Resource Website |
RRID:Addgene_129202 | Chloramphenicol and Ampicillin | PMID:29056345 | This is the empty basic yTRAP sensor plasmid. To sense aggregation of your favorite protein, clone the coding sequence into a pENTR clone, then perform LR reaction with pGAN147. The resulting expression clone should be linearized with NotI-HF enzyme prior to integration into the yeast genome. The sensor integrates into the HO locus, and can be selected for using nourseothricin. | Backbone Marker:Dirk Landgraf; Backbone Size:5056; Vector Backbone:pDML112; Vector Types:Yeast Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:23:35 | 0 | |||
|
pMW#2 Resource Report Resource Website |
RRID:Addgene_13349 | HIS3 reporter | Chloramphenicol and Ampicillin | PMID:16777607 | Please note that the ccdB cassette in the author's map (click on 'View map') is shown in the reverse orientation. Y1H Destination vector that can be used in conventional Gateway LR cloning reactions. This vector contains a Gateway cassette with AttR4 and AttL1 recombination sites and a HIS3 reporter gene. For more information and protocols, see Deplancke et al. 2004 Genome Res 14(10B):2093 and Deplancke et al. 2006 CSH Protocols. | Backbone Marker:Invitrogen; Backbone Size:7000; Vector Backbone:pDEST6; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:24:54 | 0 | ||
|
pAW Resource Report Resource Website |
RRID:Addgene_133893 | Chloramphenicol and Ampicillin | PMID:30217970 | Backbone Size:9709; Vector Backbone:pAW; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:25:00 | 0 | ||||
|
pGL4.23-SCP1-ccdB Resource Report Resource Website |
RRID:Addgene_131628 | Chloramphenicol and Ampicillin | PMID:29151363 | Backbone Marker:Promega; Backbone Size:5813; Vector Backbone:pGL4.23; Vector Types:Mammalian Expression, Bacterial Expression, Luciferase; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:24:12 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
