Plasmids   Select Another Resource Report Type

http://www.addgene.org/61917

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG argH Precursor strain = ML23 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61917 Copy   

•   Source: Addgene

http://www.addgene.org/61918

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA Precursor strain = ML26 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61918 Copy   

•   Source: Addgene

http://www.addgene.org/61914

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = tyrA hisG Precursor strain = ML14 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Tyr), His Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61914 Copy   

•   Source: Addgene

http://www.addgene.org/61151

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:NA; Vector Types:; Bacterial Resistance:None
References:
Comments: In addition to the wt copy of lacI, another copy of lacI driven by PIq is integrated at the attB Contains another copy of araC driven by a constitutive promoter in addition to wt araC.

Proper citation: RRID:Addgene_61151 Copy   

•   Source: Addgene

http://www.addgene.org/61922

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cyo ilvE avtA aspC hisG argH metA lysA thrC asnA asnB Precursor strain = ML42 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = (Ala#), Ile, Leu*, Tyr#, Val, His, Arg, Met, Lys, Thr, Asn *In the presence of 0.4-1 mM Tyr, tyrB is repressed and Leu is required for growth in minimal medium. This strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign genes [Methods 55, 370-378 (2011)]. #In the presence of 0.4-1 mM Tyr, tyrB is repressed and Tyr is required for growth in minimal medium. Under these conditions, this strain can also be used for selective labeling of the input Tyr and/or Ala label(s), although minor diffusion of the input label(s) can occur. Note that this strategy can only be applicable for a short-term cultivation but not suitable for a long-term cultivation for heterologous expression of foreign geness [Methods 55, 370-378 (2011)]. Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain.

Proper citation: RRID:Addgene_61922 Copy   

•   Source: Addgene

http://www.addgene.org/61960

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = cysE hisG Precursor strain = YM138 modified from the parent Escherichia coli C43(DE3) strain Selective amino acid labeling (and/or requirement) = Cys, His Each target gene was deleted from the chromosome of C43 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61960 Copy   

•   Source: Addgene

http://www.addgene.org/61962

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = glyA Precursor strain = BL21 CodonPlus (DE3)-RIL Selective amino acid labeling (and/or requirement) = Gly Each target gene was deleted from the chromosome of BL21 (DE3) E. coli strain using λ-Red recombination system. Supplemental documents contain a list of PCR primers used for verification of each knocked-out gene as well as an image showing PCR results for this strain. This work is supported in part by JSPS-NSF International Collaborations in Chemistry (ICC) research grant.

Proper citation: RRID:Addgene_61962 Copy   

•   Source: Addgene

http://www.addgene.org/61162

Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at galK

Proper citation: RRID:Addgene_61162 Copy   

•   Source: Addgene

http://www.addgene.org/61161

Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: HL1745 + PLlacO-1::T710::yfp intergrated at galK

Proper citation: RRID:Addgene_61161 Copy   

•   Source: Addgene

http://www.addgene.org/61166

Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at yjiP + ∆lacI

Proper citation: RRID:Addgene_61166 Copy   

•   Source: Addgene

http://www.addgene.org/61165

Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at yfjV + ∆lacI

Proper citation: RRID:Addgene_61165 Copy   

•   Source: Addgene

http://www.addgene.org/69778

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_69778 Copy   

•   Source: Addgene

http://www.addgene.org/69775

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_69775 Copy   

•   Source: Addgene

http://www.addgene.org/69774

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_69774 Copy   

•   Source: Addgene

http://www.addgene.org/69782

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_69782 Copy   

•   Source: Addgene

http://www.addgene.org/69781

Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:

Proper citation: RRID:Addgene_69781 Copy   

•   Source: Addgene

http://www.addgene.org/115924

Species:
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: E. coli K12 MG1655 genotype: F- λ- ilvG- rfb-50 rph-1 Integration at lambda attB: pOSIP-KL-sulA-GFP Integration at HK022 attB: pOSIP-KO-RBS2-dCas9 SulA-GFP acts as an SOS response reporter.

Proper citation: RRID:Addgene_115924 Copy   

•   Source: Addgene

http://www.addgene.org/192874

Species: Other
Genetic Insert: The strain has a 535 nt deletion between nt 15 and nt 551 in the EntD gene.
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: EntD, a 4'-phosphopantetheinyl transferase, is required for native enterobactin synthesis. This strain allows for expression of nonribosomal peptide synthetase (NRPS) carrier proteins that do not harbor a phosphopantetheinyl group.

Proper citation: RRID:Addgene_192874 Copy   

•   Source: Addgene

http://www.addgene.org/200839

Species: Other
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Corresponding wild-type strain (rapZ+, glmZ+, glmY+) for strain Z956 (Addgene Bacterial strain #200838).

Proper citation: RRID:Addgene_200839 Copy   

•   Source: Addgene

http://www.addgene.org/191530

Species: Other
Genetic Insert: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Derived from BL21(AI), grow in LB in BSL1 laboratory conditions Genotype: E. coli B F– ompT gal dcm lon hsdSB(rB–mB–) [malB+]K-12(λS) araB::T7RNAP-tetA Δretron-Eco1 Genotyping primers: CATGTGCATGAAAACCACTGC / CTGGTTGGACGAAGAAGTGC (273 base amplicon)

Proper citation: RRID:Addgene_191530 Copy   

•   Source: Addgene