Searching the RRID Resource Information Network
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pBC082 Resource Report Resource Website |
RRID:Addgene_202241 | bc109 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:32 | 0 | |
|
pBC083 Resource Report Resource Website |
RRID:Addgene_202242 | bc110 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:32 | 0 | |
|
pBC129 Resource Report Resource Website |
RRID:Addgene_202256 | bc156 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC099; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
pBC128 Resource Report Resource Website |
RRID:Addgene_202255 | bc155 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC099; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
pBC134 Resource Report Resource Website |
RRID:Addgene_202261 | bc161 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC101; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
pBC135 Resource Report Resource Website |
RRID:Addgene_202262 | bc162 | Synthetic | Other | PMID:38503974 | This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. | Vector Backbone:pBCC101; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-04-10 01:05:33 | 0 | |
|
ATMW1 Resource Report Resource Website |
RRID:Addgene_218768 | EcNR1 pUltraG ScW40 CCA trpS::ZeoR trpT::gentR dgalK lambdaRED::galK | Other | Other | PMID:28192410 | Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-08-01 01:07:04 | 0 | ||
|
ATMW-BL21 Resource Report Resource Website |
RRID:Addgene_218769 | pUltraG ScW40CCA BL21 trpT::gentR trpS::zeoR | Other | Other | PMID:34655653 | Vector Backbone:n/a; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2024-08-01 01:07:04 | 0 | ||
|
psBIG1b Resource Report Resource Website |
RRID:Addgene_229958 | Other | PMID: | Please visit https://doi.org/10.1101/2024.04.18.590029 for bioRxiv preprint. | Vector Backbone:pBIG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Other | 2025-02-21 01:09:00 | 0 | |||
|
psBIG1c Resource Report Resource Website |
RRID:Addgene_229959 | Other | PMID: | Please visit https://doi.org/10.1101/2024.04.18.590029 for bioRxiv preprint. | Vector Backbone:pBIG; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Other | 2025-02-21 01:09:00 | 0 | |||
|
pBMTL-6 Resource Report Resource Website |
RRID:Addgene_22816 | Other | PMID:16496398 | Backbone Size:5922; Vector Backbone:pBMTL-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | ||||
|
pBTL-6 Resource Report Resource Website |
RRID:Addgene_22810 | Other | PMID:16496398 | Addgene's QC sequence shows a 1bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity. | Backbone Size:4677; Vector Backbone:pBTL-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | |||
|
pBT-6 Resource Report Resource Website |
RRID:Addgene_22829 | Other | PMID:16496398 | Addgene's QC sequence shows a 1bp gap with the depositor's provided sequence. The lab does not believe this affects the plasmid activity. | Backbone Size:4617; Vector Backbone:pBT-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | |||
|
pBTB-6 Resource Report Resource Website |
RRID:Addgene_22822 | Other | PMID:16496398 | Backbone Size:5799; Vector Backbone:pBTB-6; Vector Types:Bacterial Expression; Bacterial Resistance:Other | 2022-04-22 03:36:08 | 0 | ||||
|
S4246 Resource Report Resource Website |
RRID:Addgene_156372 | Other | PMID:33500394 | For this strain the depositor have verified the appropriate antibiotic resistances, validated sequencing of relevant regions, and performed a restriction enzyme digest to confirm the expected cut sites Depositor recomments the following primers to sequence the relevant regions: gaaattccttgtcgggtaagttcc gaacatcaaacattaaagggtggtatttc Depositor also recommends testing for antibiotic resistance alongside the sequencing and digestion verification. Protocol for the digestion reaction: For 50 uL reaction: 1 ug DNA 5 uL CutSmart 1 uL HpyCH4III Up to 50 uL MQ water Depositor confirmed that the resulting bands were confirmed to be shorter than the starting template | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:Other | 2022-04-22 03:29:09 | 0 | |||
|
pF2 Resource Report Resource Website |
RRID:Addgene_42520 | Other | PMID:23437314 | Backbone Marker:Stratagene; Vector Backbone:pBluescript KS-; Vector Types:Bacterial Expression, Other, Unspecified, Cloning; Bacterial Resistance:Other | 2022-04-22 03:40:45 | 0 | ||||
|
pF2-DTA Resource Report Resource Website |
RRID:Addgene_42521 | EF1a-DTA | Other | PMID:23437314 | Vector Backbone:pF2; Vector Types:Mouse Targeting; Bacterial Resistance:Other | 2022-04-22 03:40:45 | 0 | |||
|
pF Resource Report Resource Website |
RRID:Addgene_42519 | Other | PMID:23437314 | Backbone Marker:Stratagene; Vector Backbone:pBluescript KS-; Vector Types:Bacterial Expression, Other, Unspecified, Cloning; Bacterial Resistance:Other | 2022-04-22 03:40:45 | 0 | ||||
|
MIP 247 CoMiP 4in1 with shRNA p53 Resource Report Resource Website 1+ mentions |
RRID:Addgene_63726 | Mini-intronic-plasmid intron | Homo sapiens | Other | PMID:25628230 | In addition to the publication listed above, more details can be found in Lu, et al. Mol Ther. 2013, PMID 23459514. | Backbone Marker:Joseph Wu's Lab at Stanford University; Backbone Size:8062; Vector Backbone:codon-optimized minicircle (CoMiC) construct; Vector Types:Mammalian Expression; Bacterial Resistance:Other | codon-optimised | 2022-04-22 03:46:13 | 1 |
|
Jun lab tunable CRISPRi strain Resource Report Resource Website |
RRID:Addgene_86400 | Other | PMID:27996021 | THIS IS A STRAIN. SJ_XTL219 is an E.coli K12 derivative of MG1655. It contains a tunable arabinose operon promoter PBAD to quantitatively control the expression of CRISPR-dCas9 protein over two orders of magnitude in a plasmid-free system. This tCRISPRi is reversible, and gene expression can be repressed or restored by adding or withdrawing arabinose. This tCRISPRi strain has less than 10% leaky expression. Most importantly from a practical perspective, construction of tCRISPRi to target a new gene requires only one-step of oligo recombineering to add the sgRNA. This tCRISPRi strain, in combination with recombineering, provides a simple and easy-to-implement tool for gene expression control, and is ideally suited for construction of both individual strains and high-throughput tunable knockdown libraries. | Vector Backbone:strain: SJ_XTL219; Vector Types:CRISPR; Bacterial Resistance:Other | 2022-04-22 03:52:08 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
