Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search
Reset search
Filter by records added date

See new records

Options

Current Facets and Filters

  • Bacterial Resistance:other (facet)

Recent searches

Snippet view Table view

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

105 Results - per page

Show More Columns | Download 105 Result(s)

Plasmid Name

Sort Ascending

Sort Descending

 Proper Citation

Sort Ascending

Sort Descending

 Insert Name

Sort Ascending

Sort Descending

 Organism

Sort Ascending

Sort Descending

 Bacterial Resistance

Sort Ascending

Sort Descending

 Defining Citation

Sort Ascending

Sort Descending

 Comments
Vector Backbone Description
Relevant Mutation
Record Last Update

Sort Ascending

Sort Descending

 Mentions Count

Sort Ascending

Sort Descending
R6K_BAD_mCherry-GFP_ChInt--
 
Resource Report
Resource Website 		RRID:Addgene_187396 GFP, mCherry Synthetic Other PMID: This plasmid requires a pir+ strain for growth and transformation. It will be distributed in MFDpir E. coli. MFDpir strain is auxotrophic for DAP (diaminopimelic acid), so it must be added to the media to grow and extract the plasmid (0.3 mM working concentration). Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2023-09-15 01:08:42 0
R6K_tac_GFPmut3_ChInt
 
Resource Report
Resource Website 		RRID:Addgene_187381 GFPmut3 Synthetic Other PMID: This plasmid requires a pir+ strain for growth and transformation. It will be distributed in MFDpir E. coli. MFDpir strain is auxotrophic for DAP (diaminopimelic acid), so it must be added to the media to grow and extract the plasmid (0.3 mM working concentration). Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2023-09-15 01:08:41 0
R6K_tac_dGFPmut3_ChInt
 
Resource Report
Resource Website 		RRID:Addgene_187388 dGFPmut3_AAV Synthetic Other PMID: This plasmid requires a pir+ strain for growth and transformation. It will be distributed in MFDpir E. coli. MFDpir strain is auxotrophic for DAP (diaminopimelic acid), so it must be added to the media to grow and extract the plasmid (0.3 mM working concentration). Vector Backbone:R6Kgamma; Vector Types:Bacterial Expression; Bacterial Resistance:Other C-terminal AAV tail 2023-09-15 01:08:41 0
pNR-DEST
 
Resource Report
Resource Website 		RRID:Addgene_90101 Other PMID: Backbone Size:10902; Vector Backbone:pPtPBR1; Vector Types:Other, Gateway Destination vector for protein expression in diatoms; Bacterial Resistance:Other 2023-05-10 01:06:39 0
p49202-DEST
 
Resource Report
Resource Website 		RRID:Addgene_90100 Other PMID: Backbone Size:11457; Vector Backbone:pPtPBR1; Vector Types:Other, Gateway Destination vector for protein expression in diatoms; Bacterial Resistance:Other 2023-05-10 01:06:39 0
pH4-DEST
 
Resource Report
Resource Website 		RRID:Addgene_90099 Other PMID: Backbone Size:10591; Vector Backbone:pPtPBR1; Vector Types:Other, Gateway Destination vector for protein expression in diatoms; Bacterial Resistance:Other 2023-05-10 01:06:39 0
KJ740(DE3)
 
Resource Report
Resource Website 		RRID:Addgene_179486 none Other Other PMID:35639414 λDE3 [lacI, lacUV5-T7 gene 1, ind1, sam7, nin5] F- araC14 fhuA31 lacY1 tsx-78 ΔompF480 zcb-222::Tn10 rfbC1 mgl-51 ΔompC178 rpsL136(StrR) xylA5 mtl-1 thiE1 KJ740(DE3) is a λDE3 derivative of the OmpC- & OmpF-deficient strain KJ740 that was described in Ingham C, Buechner M, Adler J, 1990, J Bacteriol 172:3577-3583. Due to the presence of the lambda (DE3) lysogen, KJ740(DE3) is compatible with expression from the T7 promoter. The (DE3) lysogen of the parent strain KJ740 was made by Debra T. Hansen using the λDE3 Lysogenization Kit 538 (EMD Millipore #69734-3). The parent strain KJ740 was obtained from the Yale E. coli Genetic Stock Center (CGSC) as strain number 12151. In contrast to BL21 derivative strains, KJ740(DE3) is not deficient in the proteases Lon and OmpT. The presence of (DE3) was confirmed by PCR by Felicia M. Craciunescu. PCR primers that may be used to verify the presence of the (DE3) lysogen: These primer pairs are expected to generate a PCR product from each of 3 genes within the (DE3) sequence, GenBank accession no. AM946981.2. There are two primer pairs per gene, therefore 6 possible PCR products. The presence of the PCR product of the expected size indicates the presence of the (DE3) lysogen. The PCR reactions will also be run on the negative control non-(DE3) parent strain, KJ740, which is expected to not generate these PCR product sizes. gene A F1 GACTACATCCGTGAGGTGAATGTGG gene A R1 GATGACGCAGGCATTATGCTCGCAG Product size = 645 bp gene A F2 CCTTTCACATCTGGACAGCGTACAG gene A R2 GTTGCTGCACCATCCTCTTCCTGC Product size = 904 bp gene H F1 GACATCTGGAATCTGCGCAAGGATGA gene H R1 CTGCAGGATTTTCCCGTCTTTCAGTG Product size = 291 bp gene H F2 GTGCGCTGGCGTATGCCTGGTATC gene H R2 CTGTTCCGTGGCTTCCCGTTCTGC Product size = 1388 bp gene J F1 CTTTACCTTCGGTGTACAGGCACTGGTG gene J R1 GTCCTGCACGAACGTCAGCGTCTG Product size = 748 bp gene J F2 CAGACAGGTTGAAACCAGCACGCGTTATC gene J R2 GTTTGCCTTCCTCCGTGTCCTCCATG Product size = 407 bp Please visit https://www.biorxiv.org/content/10.1101/2021.08.26.457821v2 for bioRxiv preprint. Vector Backbone:N/A; Vector Types:; Bacterial Resistance:Other 2024-02-11 12:03:46 0
pBC118
 
Resource Report
Resource Website 		RRID:Addgene_202279 bc145 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC096; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:33 0
pBC155
 
Resource Report
Resource Website 		RRID:Addgene_202274 bc182 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC106; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:33 0
pBC114
 
Resource Report
Resource Website 		RRID:Addgene_202276 bc141 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC091; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:33 0
pBC117
 
Resource Report
Resource Website 		RRID:Addgene_202278 bc144 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC096; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:33 0
pBC115
 
Resource Report
Resource Website 		RRID:Addgene_202277 bc142 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC091; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:33 0
pBC071
 
Resource Report
Resource Website 		RRID:Addgene_202235 bc098 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC088; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC079
 
Resource Report
Resource Website 		RRID:Addgene_202238 bc106 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC073
 
Resource Report
Resource Website 		RRID:Addgene_202237 bc100 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC088; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC080
 
Resource Report
Resource Website 		RRID:Addgene_202239 bc107 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC090; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC069
 
Resource Report
Resource Website 		RRID:Addgene_202233 bc096 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC088; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC108
 
Resource Report
Resource Website 		RRID:Addgene_202247 bc135 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC086; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC107
 
Resource Report
Resource Website 		RRID:Addgene_202246 bc134 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC086; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0
pBC160
 
Resource Report
Resource Website 		RRID:Addgene_202248 bc187 Synthetic Other PMID:38503974 This plasmid can be transformed into E. coli BW29427 supplemented with 50 µg/mL of diaminopimelic acid (DAP) or any Pir1 strain. Please visit https://doi.org/10.1101/2023.04.20.537712 for bioRxiv preprint. Vector Backbone:pBCC087; Vector Types:Bacterial Expression; Bacterial Resistance:Other 2024-04-10 01:05:32 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X

  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

About

The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.

Recent News Entries

New Release: NeuroMorpho.Org Version 8.6 (12/4/23), with 14,452 new tracings from 45 datasets

Dr. Martone on BrainFacts.org a FAIR video

With 2023 there are new NIH guidelines on data deposition, are you ready?

Contact Us

FAIR Data Informatics Lab

University of California, San Diego
9500 Gilman Drive, Mail Code 0608
La Jolla, CA 92093-0608
United States

info  scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch