Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

On page 19 showing 361 ~ 380 out of 718,359 results
Snippet view Table view Download Top 1000 Results
Click the to add this resource to a Collection

http://www.addgene.org/102985

Species:
Genetic Insert: TVA-mCherry fusion protein after CRE-mediated recombination
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV, Other, Adeno Associated Viral Vector; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102985 Copy   


  • RRID:Addgene_103039

http://www.addgene.org/103039

Species: Other
Genetic Insert: TAL-L1-2.4-VP64
Vector Backbone Description: Vector Backbone:pRN3p; Vector Types:Other, T3 in vitro transcription for expression in mammalian cells; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103039 Copy   


  • RRID:Addgene_103050

http://www.addgene.org/103050

Species: Other
Genetic Insert: VP35 gene of Ebola virus
Vector Backbone Description: Vector Backbone:pCAGGs; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103050 Copy   


  • RRID:Addgene_102992

    This resource has 1+ mentions.

http://www.addgene.org/102992

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, Other, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102992 Copy   


  • RRID:Addgene_102999

http://www.addgene.org/102999

Species: Other
Genetic Insert: SA_PcrA
Vector Backbone Description: Vector Backbone:pET22B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102999 Copy   


  • RRID:Addgene_102993

http://www.addgene.org/102993

Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, Other, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102993 Copy   


http://www.addgene.org/102994

Species: Homo sapiens
Genetic Insert: H2B-GCaMP6f
Vector Backbone Description: Backbone Marker:unknown; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102994 Copy   


http://www.addgene.org/102996

Species: Homo sapiens
Genetic Insert: Synaptophysin-GCaMP6f
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_102996 Copy   


  • RRID:Addgene_103011

http://www.addgene.org/103011

Species: Other
Genetic Insert: HBV Large envelope protein
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103011 Copy   


http://www.addgene.org/103017

Species: Saccharomyces cerevisiae
Genetic Insert: bPAC
Vector Backbone Description: Vector Backbone:pNH605; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103017 Copy   


  • RRID:Addgene_103191

http://www.addgene.org/103191

Species: Homo sapiens
Genetic Insert: hsa-miR-125b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103191 Copy   


  • RRID:Addgene_103156

http://www.addgene.org/103156

Species: Homo sapiens
Genetic Insert: hsa-let-7f-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103156 Copy   


  • RRID:Addgene_103165

http://www.addgene.org/103165

Species: Homo sapiens
Genetic Insert: hsa-miR-101-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103165 Copy   


  • RRID:Addgene_103169

http://www.addgene.org/103169

Species: Homo sapiens
Genetic Insert: hsa-miR-105-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103169 Copy   


  • RRID:Addgene_103139

http://www.addgene.org/103139

Species: Saccharomyces cerevisiae
Genetic Insert: Csy4
Vector Backbone Description: Backbone Marker:ATCC; Backbone Size:5522; Vector Backbone:p413 TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103139 Copy   


  • RRID:Addgene_103146

http://www.addgene.org/103146

Species: Homo sapiens
Genetic Insert: hsa-let-7a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.

Proper citation: RRID:Addgene_103146 Copy   


  • RRID:Addgene_103140

http://www.addgene.org/103140

Species: Saccharomyces cerevisiae
Genetic Insert: dCas9-VPR
Vector Backbone Description: Vector Backbone:pDTU-113; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103140 Copy   


  • RRID:Addgene_103141

http://www.addgene.org/103141

Species: Saccharomyces cerevisiae
Genetic Insert: gRNAs
Vector Backbone Description: Vector Backbone:dCas9v2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin
References:
Comments:

Proper citation: RRID:Addgene_103141 Copy   


http://www.addgene.org/100647

Species: Synthetic
Genetic Insert: EMMA toolkit Assembly connector H-J
Vector Backbone Description: Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
References:
Comments: DNA element with no function. It is used as a bridge to connect parts placed in position 7 and 10 of EMMA platform.

Proper citation: RRID:Addgene_100647 Copy   


http://www.addgene.org/100649

Species: Synthetic
Genetic Insert: EMMA toolkit Assembly connector Ha-K
Vector Backbone Description: Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
References:
Comments: DNA element with no function. It is used as a bridge to connect parts placed in position 8a and 11 of EMMA platform.

Proper citation: RRID:Addgene_100649 Copy   



Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
  1. SciCrunch.org Resources

    Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X