Searching the RRID Resource Information Network
Species: Danio rerio
Genetic Insert: mfap4 promoter and mTurquoise2
Vector Backbone Description: Vector Backbone:pDestTol2UbpA; Vector Types:Other, Zebrafish Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_135218 Copy
Species: Danio rerio
Genetic Insert: tiggywinkle hedgehog
Vector Backbone Description: Backbone Size:0; Vector Backbone:NA; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: twhh under control of CMV promoter.
Proper citation: RRID:Addgene_17060 Copy
Species: Danio rerio
Genetic Insert: wnt8
Vector Backbone Description: Backbone Size:4350; Vector Backbone:pCS2+MT; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: ORFs ligated into BamHI, ClaI cut pCS2+MT. Adds 6 myc tags onto carboxy terminus of each.
For Sense RNA: cut with Asp718 I and transcribe with SP6 polymerase.
Plasmid History:
Species of Sequence Origin: Zebrafish.
Proper citation: RRID:Addgene_17050 Copy
Species: Danio rerio
Genetic Insert: wnt8 ORF1/2
Vector Backbone Description: Backbone Size:4350; Vector Backbone:pCS2+MT; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: wnt8 ORFs + IREs cloned into BamHI-ClaI sites of pCS2+MT. Adds 6 myc tags onto c-terminus of ORF2.
For Sense RNA: cut with Asp718 I and transcribe with SP6 polymerase.
Plasmid History:
Species of Sequence Origin: Zebrafish.
Proper citation: RRID:Addgene_17052 Copy
Species: Danio rerio
Genetic Insert: wnt8
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2P+ (modified pCS2+); Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: ORF1 amplified from pBand 3-5 (full length cDNA clone) ligated into BamHI-StuI cut CS2P+.
For Sense RNA: cut with Asp718 I and transcribe with SP6 polymerase.
Plasmid History:
Species of Sequence Origin: Zebrafish.
Proper citation: RRID:Addgene_17048 Copy
Species: Danio rerio
Genetic Insert: wnt8
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2P+ (modified pCS2+); Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments: ORF2 amplified from pBand 3-5 ligated into BamHI-StuI cut CS2P+.
For Sense RNA: cut with Asp718 I and transcribe with SP6 polymerase.
Plasmid History:
Species of Sequence Origin: Zebrafish.
Proper citation: RRID:Addgene_17049 Copy
Species: Danio rerio
Genetic Insert: vox-2
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Other, Zebrafish Expression; Bacterial Resistance:Ampicillin
References:
Comments: Zvox-2 coding region amplified by PCR and inserted into CS2+ (first cloned into SK as zV93).
For RNA: cut with Asp718 and transcribe with SP6.
Plasmid History:
Species of Sequence Origin: Zebrafish.
Constructed by: David Kimelman, 6/28/97 XIX p. 67.
Proper citation: RRID:Addgene_17064 Copy
Species: Danio rerio
Genetic Insert: Stbm
Vector Backbone Description: Backbone Size:4100; Vector Backbone:pCS2+; Vector Types:Other, Zebrafish Expression; Bacterial Resistance:Ampicillin
References:
Comments: 6-c-myc epitopes in frame at the amino terminus of wild type zebrafish strabismus; EcoRI-Xba1 insert.
For Sense RNA: linearize with ASP 718 and transcribe with SP6 polymerase.
Plasmid History:
Species of Sequence Origin: Zebrafish.
Reference: M. Park and R. Moon, Nature Cell Biology 4, 20-25, 2002.
Proper citation: RRID:Addgene_17068 Copy
Species: Danio rerio
Genetic Insert: lck:mNeonGreen
Vector Backbone Description: Backbone Marker:Stephen Ekker (Plasmid #31829); Backbone Size:7065; Vector Backbone:pminiTol2; Vector Types:Other, Zebrafish expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_163695 Copy
Species: Danio rerio
Genetic Insert: CD44b
Vector Backbone Description: Vector Backbone:pT3TS-Dest_R1-R3 (Addgene 140878); Vector Types:Other, In vitro transcription of RNA; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_163850 Copy
Species: Danio rerio
Genetic Insert: Cavin4b
Vector Backbone Description: Vector Backbone:pT3TS-Dest_R1-R3 (Addgene 140878); Vector Types:Other, In vitro transcription of RNA; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_163851 Copy
Species: Danio rerio
Genetic Insert: Cavin4b
Vector Backbone Description: Vector Backbone:pDest-Tol2-pA2; Vector Types:Other, Zebrafish expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_163854 Copy
Species: Danio rerio
Genetic Insert: Cavin4a
Vector Backbone Description: Vector Backbone:pDest-Tol2-pA2; Vector Types:Other, Zebrafish expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_163853 Copy
Species: Danio rerio
Genetic Insert: beta actin 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:7903; Vector Backbone:pDestTol2pA; Vector Types:Other, Gateway Donor Vector; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_162069 Copy
Species: Danio rerio
Genetic Insert: ythdf1
Vector Backbone Description: Vector Backbone:pSP64T; Vector Types:Other, Production of mRNA for zebrafish injection.; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_164488 Copy
Species: Danio rerio
Genetic Insert: kcnma1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2550; Vector Backbone:pDONR221; Vector Types:Other, PCR cloning vector; Bacterial Resistance:Kanamycin
References:
Comments: The DNA sequence was amplified from pooled wild type TAB zebrafish embryos. There is a likely polymorphism, N416D, which is not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. But this will not impact the result of whole mount in situ hybridization
Proper citation: RRID:Addgene_164951 Copy
Species: Danio rerio
Genetic Insert: kcnmb3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:Other, PCR cloning vector; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_164955 Copy
Species: Danio rerio
Genetic Insert: kcnn1a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:Other, PCR cloning vector; Bacterial Resistance:Kanamycin
References:
Comments: The DNA sequence was amplified from pooled wild-type TAB zebrafish embryos. According to the predicted sequence, XP_005171293.1, there are likely polymorphisms, K185E, H323Y, S599N, which are not listed in the current ENSEMBL database. This is possibly due to incomplete zebrafish genome annotation, GRCz11. In addition, at the 5’ end of the insert, there are 44bps extra forward primer dimer sequences (ATGCGGCATCGGCACGCGGGCCATGCGGCATCGGCACGCGGGCC) before the start codon. But this will not impact the result of the whole mount in situ hybridization.
Proper citation: RRID:Addgene_164956 Copy
Species: Danio rerio
Genetic Insert: kcnmb2a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:Other, PCR Cloning Vectror; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_164953 Copy
Species: Danio rerio
Genetic Insert: kcnn3
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:2580; Vector Backbone:pENTR-D-TOPO; Vector Types:Other, PCR cloning vector; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_164959 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
