Species: Synthetic
Genetic Insert: J1-BBa_J23117-sfGFP
Vector Backbone Description: Backbone Marker:Herbert Schweizer; Backbone Size:4569; Vector Backbone:pUC18TminiTn7T-Gm; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin
References:
Comments: Alternative names: pCDP009, pUC18TminiTn7T-Gm_J1-BBa_J23117-sfGFP_Sp.pCas9-dCas9_BBa_J23107-MCP-SoxS(R93A/S101A)
Used for conjugation, with pTNS1 and pRK2013 helper plasmids, to integrate J1-BBa_J23117-sfGFP, Sp.pCas9-dCas9, and BBa_J23107-MCP-SoxS(R93A/S101A) cassettes into gram-negative bacteria.
Point mutation in the FRT site was observed and remained applicable with counterselection by pCK255
Proper citation: RRID:Addgene_171139 Copy
Species: Synthetic
Genetic Insert: flagellin promoter driven msfCFP
Vector Backbone Description: Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint.
Proper citation: RRID:Addgene_118232 Copy
Species: Synthetic
Genetic Insert: flagellin promoter driven msfYFP
Vector Backbone Description: Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments: Please visit https://www.biorxiv.org/content/early/2018/09/21/363390 for bioRxiv preprint.
Proper citation: RRID:Addgene_118233 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Esteban Martínez-García and Víctor de Lorenzo; Backbone Size:3168; Vector Backbone:pEMG; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_122093 Copy
Species: Synthetic
Genetic Insert: PA1/04/03-eyfp
Vector Backbone Description: Vector Backbone:pBK-miniTn7-omegaGm (pUC-based); Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_111620 Copy
Species: Synthetic
Genetic Insert: PcdrA-RBSII-gfp(ASV)-T0-T1
Vector Backbone Description: Vector Backbone:pBK-miniTn7-omegaGm (pUC-based); Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_111617 Copy
Species: Synthetic
Genetic Insert: PpqsA-gfp(ASV)
Vector Backbone Description: Vector Backbone:pUCP22Not; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments: GFP(AAV)- GFP variant with a shorter half life.
Proper citation: RRID:Addgene_111618 Copy
Species: Synthetic
Genetic Insert: PA1/04/03-ecfp
Vector Backbone Description: Vector Backbone:pBK-miniTn7-omegaGm (pUC-based); Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_111619 Copy
Species: Homo sapiens
Genetic Insert: Hook3(1-552)-GFP
Vector Backbone Description: Backbone Size:2857; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments: Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_111861 Copy
Species: Mus musculus
Genetic Insert: BICDN(1-400)-GFP
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments: Please note that there are some discrepancies between Addgene's quality control sequence and the depositor's sequence. The depositor noted that these discrepancies do NOT affect plasmid function.
Proper citation: RRID:Addgene_111862 Copy
Species: Arabidopsis thaliana
Genetic Insert: ARABIDOPSIS DEHISCENCE ZONE POLYGALACTURONASE 2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway Donor vector / entry clone; Bacterial Resistance:Gentamicin
References:
Comments: For use with Three-way Multi-site Gateway Cloning (Invitrogen).
Proper citation: RRID:Addgene_170725 Copy
Species: Homo sapiens
Genetic Insert: MZT2A
Vector Backbone Description: Backbone Marker:Geneva Biotech; Vector Backbone:pACEBac1; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_178074 Copy
Species: Aequorea
Genetic Insert: unstable gfp-mut3.1 LAA
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pbbr; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin
References:
Comments: Use gentamicin at 10 ug/mL.
Proper citation: RRID:Addgene_14463 Copy
Species: Homo sapiens
Genetic Insert: KIF5B (full length, 1-963 amino acids), K963
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_159727 Copy
Species: Homo sapiens
Genetic Insert: KIF5B (only amino acids 1-560), K560
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_159720 Copy
Species: Homo sapiens
Genetic Insert: KIF5B (only amino acids 1-490), K490
Vector Backbone Description: Vector Backbone:pOmnibac; Vector Types:Insect Expression; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_159721 Copy
Species:
Genetic Insert: Luciferase miR-shRNA
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:4990; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin
References:
Comments: Entry vector with TRE-driven luciferase miR-shRNA and co-expressed GFP
Luciferase shRNA sequence is - 5'- CCCGCCTGAAGTCTCTGATTAATAGTGAAGCC ACAGATGTATTAATCAGAGACTTCAGGCGGT
Proper citation: RRID:Addgene_25765 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:ATCC 10326362; Backbone Size:5303; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin
References:
Comments: shRNA expression; miR30-based topology; TRE Pmin promoter + GFP spacer; Entry vector backbone; +ccdB in parent; Multiple unique sites d/s of TRE
Proper citation: RRID:Addgene_25749 Copy
Species:
Genetic Insert: CFP
Vector Backbone Description: Backbone Size:9449; Vector Backbone:pMMB67EH; Vector Types:Bacterial Expression, Other, Broad-host range; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_90103 Copy
Species:
Genetic Insert: YcgR
Vector Backbone Description: Backbone Size:9449; Vector Backbone:pMMB67EH; Vector Types:Bacterial Expression, Other, Broad-host range; Bacterial Resistance:Gentamicin
References:
Comments:
Proper citation: RRID:Addgene_90102 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.