Species: Other
Genetic Insert: kanamycin casette and p0050 promoter
Vector Backbone Description: Backbone Size:4400; Vector Backbone:pBR322; Vector Types:Other, Cloning vector; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_101828 Copy
Species: Other
Genetic Insert: N-ethylmaleimide sensitive factor
Vector Backbone Description: Vector Backbone:pPROEX1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102239 Copy
Species: Other
Genetic Insert: β-glucosidase
Vector Backbone Description: Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_101912 Copy
Species: Other
Genetic Insert: β-glucosidase
Vector Backbone Description: Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_101910 Copy
Species: Other
Genetic Insert: β-glucosidase
Vector Backbone Description: Backbone Size:5711; Vector Backbone:pET16b; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_101911 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Bassik lab (Addgene Plasmid #89359); Vector Backbone:pMCB320; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_101928 Copy
Species: Homo sapiens
Genetic Insert: USP15_SART3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SART3|USP15:YTC044-A09:C237276. SGC or PDG link: http://www.thesgc.org/structures/5JJW/
Proper citation: RRID:Addgene_101880 Copy
Species: Homo sapiens
Genetic Insert: SETDB1
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETDB1:APC043-C07:C27642.
SGC or PDG links:
5KCH http://www.thesgc.org/structures/5KCH/
6AU2 http://www.thesgc.org/structures/6AU2/
6AU3 http://www.thesgc.org/structures/6AU3/
6BPI http://www.thesgc.org/structures/6BPI/
5KCO http://www.thesgc.org/structures/5KCO/
5KE2 http://www.thesgc.org/structures/5KE2/
5KE3 http://www.thesgc.org/structures/5KE3/
5KH6 http://www.thesgc.org/structures/5KH6/
Proper citation: RRID:Addgene_101881 Copy
Species: Homo sapiens
Genetic Insert: SETD8
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26096); Vector Backbone:pET28-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: SETD8:PBC001-G01:C233009. SGC or PDG link:
http://www.thesgc.org/structures/5T5G/
http://www.thesgc.org/structures/5TH7/
Proper citation: RRID:Addgene_101886 Copy
Species: Other
Genetic Insert: PP-BRD3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-F01:C235018. SGC or PDG link: http://www.thesgc.org/structures/5TCK/
Proper citation: RRID:Addgene_101887 Copy
Species: Other
Genetic Insert: PP-BRD3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: LdBPK_091320.1:MAC055-C02:C235023.
SGC or PDG links:
http://www.thesgc.org/structures/5TCM/
http://www.thesgc.org/structures/6BYA/
Proper citation: RRID:Addgene_101888 Copy
Species: Homo sapiens
Genetic Insert: PREB
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 62304); Vector Backbone:pFBOH-MHL; Vector Types:Other, Baculovirus expression; Bacterial Resistance:Ampicillin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: PREB:YTC012-F10:C229890. SGC or PDG link: http://www.thesgc.org/structures/5TF2/
Proper citation: RRID:Addgene_101889 Copy
Species: Other
Genetic Insert: PP-BRD19
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 26092); Vector Backbone:pET15-MHL; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: Tb427.10.8150:MAC054-H04:C234720. SGC or PDG link: http://www.thesgc.org/structures/5KO4/
Proper citation: RRID:Addgene_101882 Copy
Species: Homo sapiens
Genetic Insert: Rab interacting lysosomal protein
Vector Backbone Description: Backbone Size:4858; Vector Backbone:pTre2-Bla; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102425 Copy
Species:
Genetic Insert: tetracyclin-transactivator (rtTA)
Vector Backbone Description: Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers:
Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC
Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG
Proper citation: RRID:Addgene_102423 Copy
Species:
Genetic Insert: cAMPr
Vector Backbone Description: Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102437 Copy
Species:
Genetic Insert: cAMPr
Vector Backbone Description: Backbone Size:3300; Vector Backbone:P2lox; Vector Types:Mammalian Expression, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102438 Copy
Species: Homo sapiens
Genetic Insert: synuclein alpha
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5900; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid encodes a novel 18-amino-acid protein tag - "NE", which can be detected by a specific mouse monoclonal antibody in Western blotting, immunopreciptation, and immunocytochemistry. (Source of antibody: http://www.versitech.hku.hk/reagents/ne/)
Proper citation: RRID:Addgene_102361 Copy
Species: Arabidopsis thaliana
Genetic Insert: RabG3B
Vector Backbone Description: Vector Backbone:pUBN-RFP; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_102369 Copy
Species: Homo sapiens
Genetic Insert: LGALS3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA6-myc his version B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: The his-tag and myc-tag are NOT in frame with the Gal3-mAzami green.
Proper citation: RRID:Addgene_102419 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.