Searching the RRID Resource Information Network
Species: Mus musculus
Genetic Insert: Stat-1
Vector Backbone Description: Backbone Size:8858; Vector Backbone:pDR111; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_188400 Copy
Species: Mus musculus
Genetic Insert: mouse NFL
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4242; Vector Backbone:pEGFP-C1 with EGFP sequence removed; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Plasmid first described in Yan et al. (2007), "The polypeptide composition of moving and stationary neurofilaments in cultured sympathetic neurons", Cell Motility and the Cytoskeleton 64:299–309.
Mouse NFL cDNA sequence deposited in Genbank (Accession number DQ201635).
Proper citation: RRID:Addgene_83127 Copy
Species: Mus musculus
Genetic Insert: IkB alpha M
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: IkB alpha M was generated by digestion of plasmids pCMX-IkBS32/36A and pCMX-IkBMutF with Eco NI and Bst EII and ligation of the small S32/36A fragment to the large vector/IkBMutF fragment.
Proper citation: RRID:Addgene_12329 Copy
Species: Mus musculus
Genetic Insert: IkB alpha
Vector Backbone Description: Backbone Size:4500; Vector Backbone:pCMX; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_12331 Copy
Species: Mus musculus
Genetic Insert: Clathrin, light polypeptide (LCa)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Note: The clathrin light chain has an A9D amino acid residue substitution. This is a natural variant that does not affect protein function.
Proper citation: RRID:Addgene_38012 Copy
Species: Mus musculus
Genetic Insert: mouse Nefl intron3-exon4-linker(WT)-3xFLAG donor sequence
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_182682 Copy
Species: Mus musculus
Genetic Insert: NEMO shRNA1
Vector Backbone Description: Backbone Marker:Available at Addgene (#12084); Backbone Size:7700; Vector Backbone:pSicoR PGK puro; Vector Types:Mammalian Expression, Lentiviral, RNAi, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: Mouse NEMO shRNA1 in pSicoReverse (Puromycin)
forward oligo:
TGGACATGCTGGGTGAAGAATTCAAGAGATTCTTCACCCAGCATGTCCTTTTTTC
reverse oligo :
TCGAGAAAAAAGGACATGCTGGGTGAAGAATCTCTTGAATTCTTCACCCAGCATGTCCA
Proper citation: RRID:Addgene_22505 Copy
Species: Mus musculus
Genetic Insert: Clathrin, light polypeptide (LCa)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4700; Vector Backbone:pEYFP-N1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Note: The clathrin light chain has an A9D amino acid residue substitution. This is a natural variant that does not affect protein function.
Proper citation: RRID:Addgene_38010 Copy
Species: Mus musculus
Genetic Insert: Nefl-targeting gRNA and linker(A6TAG)-3xFLAG donor sequence
Vector Backbone Description: Vector Backbone:pORANGE; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_182680 Copy
Species: Mus musculus
Genetic Insert: mouse Nefl intron3-exon4-linker(TAG)-3xFLAG donor sequence
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_182686 Copy
Species: Mus musculus
Genetic Insert: mouse Nefl intron3-exon4-linker(WT)-3xFLAG donor sequence
Vector Backbone Description: Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_182685 Copy
Species: Mus musculus
Genetic Insert: Clathrin, light polypeptide (LCa)
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4000; Vector Backbone:pEYFP-C1; Vector Types:Mammalian Expression, Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: Note: The clathrin light chain has an A9D amino acid residue substitution. This is a natural variant that does not affect protein function. It is also missing its stop codon, so the peptide "PGPGSTGSR*" from the backbone is appended to the C-terminus of the CLC. The affect of this peptide on protein function is unknown.
Proper citation: RRID:Addgene_38009 Copy
Species: Mus musculus
Genetic Insert: mouse neurofilament light chain with a K363TAG mutation
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_182661 Copy
Species: Mus musculus
Genetic Insert: mouse neurofilament light chain with a K468TAG mutation
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_182663 Copy
Species: Mus musculus
Genetic Insert: IkB alpha
Vector Backbone Description: Backbone Size:11500; Vector Backbone:RCAS; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_12406 Copy
Species: Mus musculus
Genetic Insert: IkappaBalpga
Vector Backbone Description: Vector Backbone:pET15b; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44738 Copy
Species: Mus musculus
Genetic Insert: mouse neurofilament light chain with a K363TAG mutation
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_182656 Copy
Species: Mus musculus
Genetic Insert: wild type mouse neurofilament light chain
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_182659 Copy
Species: Mus musculus
Genetic Insert: mouse neurofilament light chain with a K468TAG mutation
Vector Backbone Description: Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_182658 Copy
Species: Mus musculus
Genetic Insert: Clathrin Light Chain
Vector Backbone Description: Backbone Marker:Clontech; Backbone Size:4722; Vector Backbone:pmCherry-C1; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments: Cloned from IMAGE clone: 3154277 (MGC:68133).
Proper citation: RRID:Addgene_27680 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the FDI Lab - SciCrunch.org Resources search. From here you can search through a compilation of resources used by FDI Lab - SciCrunch.org and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that FDI Lab - SciCrunch.org has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on FDI Lab - SciCrunch.org then you can log in from here to get additional features in FDI Lab - SciCrunch.org such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into FDI Lab - SciCrunch.org you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within FDI Lab - SciCrunch.org that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
The SciCrunch Infrastructure was developed as a cooperative data platform to be used by diverse communities in making data more FAIR.
scicrunch.org
