Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
http://www.wormbase.org/db/get?name=WBStrain00031058
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00011227(nlp-67)
Genomic Alteration: WBGene00011227(nlp-67)
Availability: available
References:
Synonyms: nlp-67(sy1176) X.
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of nlp-67; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CTCACTTTCTTGCTCGTCACTCTTTTTGCCCTCGCRight flanking sequence: CAATGTCATGCAAGCACAGCGTTACGATCGAGCCinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GTGCTTGCATGACATTGGCGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00031058 Copy
http://www.wormbase.org/db/get?name=WBStrain00031057
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Y55F3BL.4(sy1175) IV
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031057 Copy
http://www.wormbase.org/db/get?name=WBStrain00031055
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: cpn-4(sy1173) I
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031055 Copy
http://www.wormbase.org/db/get?name=WBStrain00031053
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: ZC376.2(sy1171) V
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031053 Copy
http://www.wormbase.org/db/get?name=WBStrain00031052
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00013874(cest-2.2)
Genomic Alteration: WBGene00013874(cest-2.2)
Availability: available
References:
Synonyms: ZC376.2(sy1170) V.
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00031052 Copy
http://www.wormbase.org/db/get?name=WBStrain00031059
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Y71H2AM.20(sy1177)/+ III
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031059 Copy
http://www.wormbase.org/db/get?name=WBStrain00031025
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: aex-2(sy1079) X
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031025 Copy
http://www.wormbase.org/db/get?name=WBStrain00031024
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00000085(aex-2)
Genomic Alteration: WBGene00000085(aex-2)
Availability: available
References:
Synonyms: aex-2(sy1078) X.
Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATGRight flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCAinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"
Proper citation: RRID:WB-STRAIN:WBStrain00031024 Copy
http://www.wormbase.org/db/get?name=WBStrain00031023
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: Y106G6H.8(sy1077) I
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031023 Copy
http://www.wormbase.org/db/get?name=WBStrain00031021
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: K03E5.2(sy1087) I
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031021 Copy
http://www.wormbase.org/db/get?name=WBStrain00031029
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: C01B10.10(sy1115) IV
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031029 Copy
http://www.wormbase.org/db/get?name=WBStrain00031033
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: C56G2.15(sy1121) III
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031033 Copy
http://www.wormbase.org/db/get?name=WBStrain00031031
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: C53C9.2(sy1117) X
Notes: aatatc
Proper citation: RRID:WB-STRAIN:WBStrain00031031 Copy
http://www.wormbase.org/db/get?name=WBStrain00031038
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: cul-3(sy1153)/+ V
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031038 Copy
http://www.wormbase.org/db/get?name=WBStrain00031037
Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: C01B10.4(sy1132) IV
Notes: STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc
Proper citation: RRID:WB-STRAIN:WBStrain00031037 Copy
http://www.wormbase.org/db/get?name=WBStrain00031124
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: available
References:
Synonyms: oyls17.
Notes: Made_by: Piali Sengupta's lab|"oyls17 [gcy-8p::GFP + lin-15(+)]. AFD neurons are marked with GFP. Used by CeNGEN project for RNA-Seq (https:"
Proper citation: RRID:WB-STRAIN:WBStrain00031124 Copy
http://www.wormbase.org/db/get?name=WBStrain00031123
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00006070(str-2)|WBGene00006853(unc-130)
Genomic Alteration: WBGene00006070(str-2), WBGene00006853(unc-130)
Availability: available
References:
Synonyms: unc-130(oy10) II.
Notes: Made_by: T. Sarafi-Reinach|"Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers."
Proper citation: RRID:WB-STRAIN:WBStrain00031123 Copy
http://www.wormbase.org/db/get?name=WBStrain00031127
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: available
References:
Synonyms: oyIs18 [gcy-8p::gfp]
Notes: oyIs18 [gcy-8::GFP]. GFP in AFD.
Proper citation: RRID:WB-STRAIN:WBStrain00031127 Copy
http://www.wormbase.org/db/get?name=WBStrain00031135
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002210(kin-29)|WBGene00003182(mef-2)
Genomic Alteration: WBGene00002210(kin-29), WBGene00003182(mef-2)
Availability: available
References:
Synonyms: mef-2(oy65) I; kin-29(oy39) kyIs104 X.
Notes: kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking.
Proper citation: RRID:WB-STRAIN:WBStrain00031135 Copy
http://www.wormbase.org/db/get?name=WBStrain00031134
Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001535(gcy-8)
Genomic Alteration: WBGene00001535(gcy-8)
Availability: unknown
References:
Synonyms: EMPTY
Notes: EMPTY
Proper citation: RRID:WB-STRAIN:WBStrain00031134 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.