Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Mus musculus
Genetic Insert: Axin
Vector Backbone Description: Backbone Size:4300; Vector Backbone:pCS2+MT; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_21287 Copy
Species: Homo sapiens
Genetic Insert: iSH2-pMagFast2(3x)-iRFP
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:5354; Vector Backbone:pcDNA3.1(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_67298 Copy
Species: Mus musculus
Genetic Insert: Gsdmd
Vector Backbone Description: Backbone Marker:Sigma; Vector Backbone:pFlag-CMV-4; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_80950 Copy
Species: Homo sapiens
Genetic Insert: MSH2
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:3000; Vector Backbone:pBluescript SK; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: A full-length clone of hMSH2 cDNA was cloned into the XbaI/XhoI site of pBluescript SK.
Proper citation: RRID:Addgene_16453 Copy
Species: Homo sapiens
Genetic Insert: SRY-box 2 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_101761 Copy
Species: Homo sapiens
Genetic Insert: transforming growth factor beta 1 promoter
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:4818; Vector Backbone:pGL3; Vector Types:Mammalian Expression, Luciferase; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_101762 Copy
Species: Homo sapiens
Genetic Insert: METTL3
Vector Backbone Description: Backbone Marker:Cheryl Arrowsmith (Addgene plasmid # 62304); Vector Backbone:pFBOH-MHL; Vector Types:Other, Baculovirus expression; Bacterial Resistance:Ampicillin
References:
Comments: N terminal tag: MHHHHHHSSGRENLYFQG. SGC Clone Sample ID: METTL3:JMC094-C09:C231635. SGC or PDG link: http://www.thesgc.org/structures/5TEY/
Proper citation: RRID:Addgene_101892 Copy
Species:
Genetic Insert: tetracyclin-transactivator (rtTA)
Vector Backbone Description: Backbone Marker:Austin Smith lab; Vector Backbone:pPBCAG-rtTAM2-IN; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: IRES-Hygro was amplified from pLVX-IRES-Hyg (Clontech) for Gibson cloning using the following primers:
Forward primer: TTTTGACCTTGACATGCTCCCCGGGTAAGCTCGAGACTAGTTCTAGAGCGGCCGCGGATC
Reverse primer: CCATGATATTCGGCAAGCAGGCATCGCCATGGCTATTCCTTTGCCCTCGGACGAGTGCTG
Proper citation: RRID:Addgene_102423 Copy
Species:
Genetic Insert: Pink Flamindo
Vector Backbone Description: Vector Backbone:pcDNA3.1(-); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102356 Copy
Species: Homo sapiens
Genetic Insert: MYC
Vector Backbone Description: Backbone Size:4319; Vector Backbone:pCMV-Tag-4A; Vector Types:Mammalian Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_102625 Copy
Species: Mus musculus
Genetic Insert: cGAS
Vector Backbone Description: Vector Backbone:pcDNA3.1-Hygro(+); Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102607 Copy
Species: Homo sapiens
Genetic Insert: RPA1
Vector Backbone Description: Vector Backbone:pET11d; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102613 Copy
Species:
Genetic Insert: gRNAScaffold_hU6promoter
Vector Backbone Description: Backbone Size:3250; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:Other, as PCR template; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_102843 Copy
Species:
Genetic Insert: STAgR Insert gRNAScaffold_mU6
Vector Backbone Description: Backbone Marker:Stricker Lab; Vector Backbone:PCR Template for STAgR Reactions; Vector Types:Other, PCR Template for STAgR Inserts; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_102844 Copy
Species:
Genetic Insert: TVA-mCherry fusion protein after CRE-mediated recombination
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:AAV, Other, Adeno Associated Viral Vector; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102985 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, Other, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102992 Copy
Species: Rattus norvegicus
Genetic Insert: BE4-Gam
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_100806 Copy
Species: Synthetic
Genetic Insert: CDA1-BE3
Vector Backbone Description: Backbone Size:3402; Vector Backbone:pCMV; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_100804 Copy
Species: Synthetic
Genetic Insert: GCaMP6s
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid was previously available as pAAV.Syn.GCaMP6s.WPRE.SV40( p2824) from the Penn Vector Core. This plasmid was created as part of the GENIE project at Janelia Research Campus.
Proper citation: RRID:Addgene_100843 Copy
Species: Synthetic
Genetic Insert: GCaMP6m
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments: This plasmid was previously available as pAAV.Syn.Flex.GCaMP6m.WPRE.SV40 (p2820) from the Penn Vector Core. This plasmid was created as part of the GENIE project at Janelia Research Campus.
Proper citation: RRID:Addgene_100838 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the SPARC SAWG Resources search. From here you can search through a compilation of resources used by SPARC SAWG and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that SPARC SAWG has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on SPARC SAWG then you can log in from here to get additional features in SPARC SAWG such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into SPARC SAWG you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within SPARC SAWG that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.