Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
| Organism Name | Proper Citation | Species | Synonyms |
Notes |
Phenotype | Affected Gene | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
PS8009 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031053 | Caenorhabditis elegans | ZC376.2(sy1171) V | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031053 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS8009 | 2026-02-14 12:17:36 | 0 | ||||
|
PS8008 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031052 | Caenorhabditis elegans | ZC376.2(sy1170) V. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00013874(cest-2.2) | WBGene00013874(cest-2.2) | WB-STRAIN:WBStrain00031052 | WormBase (WB) | WB | available | PMID:30224336 | WB-STRAIN:PS8008, CGC_PS8008 | 2026-02-14 12:17:36 | 0 | ||
|
PS8028 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031059 | Caenorhabditis elegans | Y71H2AM.20(sy1177)/+ III | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031059 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS8028 | 2026-02-14 12:17:36 | 0 | ||||
|
PS7838 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031025 | Caenorhabditis elegans | aex-2(sy1079) X | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031025 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7838 | 2026-02-14 12:17:35 | 0 | ||||
|
PS7837 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031024 | Caenorhabditis elegans | aex-2(sy1078) X. | Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of aex-2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette).Left flanking sequence: CGGAAACGGCTTTTATGGATTACTGCAGCGACATGRight flanking sequence: GGGAGGACTTTATGCAATGAACATCGCACTTGTCAinserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : ATTACTGCAGCGACATGGGGMethod Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616" | WBGene00000085(aex-2) | WBGene00000085(aex-2) | WB-STRAIN:WBStrain00031024 | WormBase (WB) | WB | available | PMID:30224336 PMID:38590801 |
WB-STRAIN:PS7837, CGC_PS7837 | 2026-02-14 12:17:35 | 0 | ||
|
PS7834 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031023 | Caenorhabditis elegans | Y106G6H.8(sy1077) I | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031023 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7834 | 2026-02-14 12:17:35 | 0 | ||||
|
PS7784 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031021 | Caenorhabditis elegans | K03E5.2(sy1087) I | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031021 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7784 | 2026-02-14 12:17:35 | 0 | ||||
|
PS7859 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031029 | Caenorhabditis elegans | C01B10.10(sy1115) IV | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031029 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7859 | 2026-02-14 12:17:35 | 0 | ||||
|
PS7910 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031033 | Caenorhabditis elegans | C56G2.15(sy1121) III | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031033 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7910 | 2026-02-14 12:17:35 | 0 | ||||
|
PS7899 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031031 | Caenorhabditis elegans | C53C9.2(sy1117) X | aatatc | WB-STRAIN:WBStrain00031031 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7899 | 2026-02-14 12:17:35 | 0 | ||||
|
PS7937 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031038 | Caenorhabditis elegans | cul-3(sy1153)/+ V | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031038 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7937 | 2026-02-14 12:17:36 | 0 | ||||
|
PS7923 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031037 | Caenorhabditis elegans | C01B10.4(sy1132) IV | STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc | WB-STRAIN:WBStrain00031037 | WormBase (WB) | WB | unknown | PMID:30224336 | WB-STRAIN:PS7923 | 2026-02-14 12:17:36 | 0 | ||||
|
PY1157 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031124 | Caenorhabditis elegans | oyls17. | Made_by: Piali Sengupta's lab|"oyls17 [gcy-8p::GFP + lin-15(+)]. AFD neurons are marked with GFP. Used by CeNGEN project for RNA-Seq (https:" | WBGene00001535(gcy-8) | WBGene00001535(gcy-8) | WB-STRAIN:WBStrain00031124 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:PY1157, CGC_PY1157 | 2026-02-14 12:17:37 | 0 | ||
|
PY1133 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031123 | Caenorhabditis elegans | unc-130(oy10) II. | Made_by: T. Sarafi-Reinach|"Slighty Dpy. Slighty Unc. Ventral clear patch due to distal tip cell migration defects. Ectopic expression of AWA neuronal markers." | WBGene00006070(str-2)|WBGene00006853(unc-130) | WBGene00006070(str-2), WBGene00006853(unc-130) | WB-STRAIN:WBStrain00031123 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:PY1133, CGC_PY1133 | 2026-02-14 12:17:37 | 0 | ||
|
PY1322 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031127 | Caenorhabditis elegans | oyIs18 [gcy-8p::gfp] | oyIs18 [gcy-8::GFP]. GFP in AFD. | WBGene00001535(gcy-8) | WBGene00001535(gcy-8) | WB-STRAIN:WBStrain00031127 | WormBase (WB) | WB | available | PMID:38530893 | WB-STRAIN:PY1322, CGC_PY1322 | 2026-02-14 12:17:37 | 1 | ||
|
PY2223 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031135 | Caenorhabditis elegans | mef-2(oy65) I; kin-29(oy39) kyIs104 X. | kyIs104 [str-1::GFP]. AWB expression of GFP. mef-2 suppresses the phenotypes of kin-29 (small body size, hypersensitivity to dauer pheromone, reduced expression of the str-1 chemoreceptor in the AWB olfactory neurons). WT looking. | WBGene00002210(kin-29)|WBGene00003182(mef-2) | WBGene00002210(kin-29), WBGene00003182(mef-2) | WB-STRAIN:WBStrain00031135 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:PY2223, CGC_PY2223 | 2026-02-14 12:17:37 | 0 | ||
|
PY1669 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031134 | Caenorhabditis elegans | EMPTY | EMPTY | WBGene00001535(gcy-8) | WBGene00001535(gcy-8) | WB-STRAIN:WBStrain00031134 | WormBase (WB) | WB | unknown | EMPTY | WB-STRAIN:PY1669 | 2026-02-14 12:17:37 | 0 | ||
|
PY1589 Resource Report Resource Website 1+ mentions |
RRID:WB-STRAIN:WBStrain00031132 | Caenorhabditis elegans | cmk-1(oy21) IV. | Thermotaxis defective. | WBGene00000553(cmk-1) | WBGene00000553(cmk-1) | WB-STRAIN:WBStrain00031132 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:PY1589, CGC_PY1589 | 2026-02-14 12:17:37 | 3 | ||
|
PY1539 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031131 | Caenorhabditis elegans | ref-1(oy40) II. | WT phenotype. | WBGene00004334(ref-1) | WBGene00004334(ref-1) | WB-STRAIN:WBStrain00031131 | WormBase (WB) | WB | available | EMPTY | WB-STRAIN:PY1539, CGC_PY1539 | 2026-02-14 12:17:37 | 0 | ||
|
PY1479 Resource Report Resource Website |
RRID:WB-STRAIN:WBStrain00031130 | Caenorhabditis elegans | kin-29(oy38) X. | Animals are small, developmentally delayed, and have reduced expression of certain olfactory receptors. oy38 is a complex rearrangement of kin-29 genomic sequences. | WBGene00002210(kin-29) | WBGene00002210(kin-29) | WB-STRAIN:WBStrain00031130 | WormBase (WB) | WB | available | PMID:36652499 | WB-STRAIN:PY1479, CGC_PY1479 | 2026-02-14 12:17:37 | 0 |
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
