Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 8 showing 141 ~ 160 out of 224 results
Snippet view Table view Download 224 Result(s)
Click the to add this resource to a Collection

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299144

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Trdn gene. Rat Resource and Research Center

Proper citation: RRID:RRRC_00368 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2311694

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the Fam227a gene. Rat Resource & Research Center

Proper citation: RRID:RRRC_00484 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2313465

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Pld5 gene. Rat Resource and Research Center

Proper citation: RRID:RRRC_00483 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2314339

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 15th intron of the Inadl gene. Rat Resource & Research Center

Proper citation: RRID:RRRC_00480 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299133

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169). This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 9th intron of the Rap1gds1 gene. Rat Resource and Research Center

Proper citation: RRID:RRRC_00357 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2311692

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 18th intron of the Myo1d gene. Rat Resource and Research Center

Proper citation: RRID:RRRC_00478 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2303977

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 1st intron of the Tmem16c gene. Rat Resource & Research Center

Proper citation: RRID:RRRC_00477 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299148

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 3rd intron of the Immp1l gene. Rat Resource & Research Center

Proper citation: RRID:RRRC_00355 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=2299135

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: These Sleeping Beauty mutants were derived by crossing F344-TgTn(T2/Bart3)2Ceb (RGD:2290163) and F344-Tg(PGK2-sb11)Ceb (RGD:2290169).This mutation consists of an insertion of a Sleeping Beauty transposable element gene trap construct into the 2nd intron of the Mgat4c gene. Rat Resource and Research Center

Proper citation: RRID:RRRC_00354 Copy   


http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11667084

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: ENU induced total juvenile cataract in inbred Wistar. Rat Resource and Research Center

Proper citation: RRID:RRRC_00704 Copy   


  • RRID:RRRC_00705

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11667094

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: transgenic
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: micro-injected with a ~6 kb transgenic cassette, which contained a CMV enhancer, chicken beta-actin promoter, the full-length cDNA encoding human complement factor H, and a rabbit beta-globin poly(A) sequence that had been isolated and purified from plasmid pCAGGS-human fH. Rat Resource and Research Center

Proper citation: RRID:RRRC_00705 Copy   


  • RRID:RRRC_00754

    This resource has 1+ mentions.

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11084925

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: transgenic
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: Transgene: human CD59 gene (cDNA) under control of alpha-globin regulatory elements (alpha-globin promoter and alpha hemoglobin locus control region). Upon administration of intermedilysin (ILY), cells expressing human CD59 will be selectively ablated Rat Resource and Research Center

Proper citation: RRID:RRRC_00754 Copy   


  • RRID:RRRC_00755

    This resource has 1+ mentions.

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=11084928

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: The mutation was generated using zinc finger nuclease technology. The mutation involves insertion of one extra C at position 16:20486368 in the intronless JunD gene (Rat (Rnor_6.0)Ensembl) resulting in a null mutation. Rat Resource and Research Center

Proper citation: RRID:RRRC_00755 Copy   


  • RRID:RGD_4139874

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139874

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence aacccatgtccgggattgggtgatgtgggctgtgaatgag into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 3.

Proper citation: RRID:RGD_4139874 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139875

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ataaacctttcccaggatacattgacccggattct into FHH-Chr 1BN/Mcwi embryos. The resulting mutation is a 14-bp frameshift deletion mutation in exon 20.

Proper citation: RRID:RGD_4139875 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139877

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CACCAAAACTTCTCCTCCCACTACCGGGCCACCATTGGT into FHH.BN-(D1Hmgc14-D1Hmgc15)/Mcwi rat embryos. The resulting mutation is a 1-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_4139877 Copy   


  • RRID:RGD_5143988

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143988

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCCACTGCTCCtcaaaCCCATGTCTAAGCAGGAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 4-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5143988 Copy   


  • RRID:RGD_5143986

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5143986

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CGCTCTACATGGCTCCTGAgatggtGTGTCGGCGGCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 5.

Proper citation: RRID:RGD_5143986 Copy   


  • RRID:RGD_5131991

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131991

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence TATCACTGCCACAACagcttcAAGGCCACAGGGAACAGGTC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 2.

Proper citation: RRID:RGD_5131991 Copy   


  • RRID:RGD_5131911

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131911

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2017-01-26)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CCCGCCTCCGACTCCGCCtccgtcCTCCCGGCACCAGTA into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_5131911 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X