Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 6 showing 101 ~ 120 out of 1,575 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00047453

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001072(dpy-10)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001072(dpy-10), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: +/mT1[umnIs52] II; K12H4.5(ve547[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP])/mT1 [dpy-10(e128)] III.
Notes: Made_by: RG KO Group|"umnIs52 [myo-2p::mKate2 + NeoR, III: 8856215 (intergenic)] II. Homozygous lethal. Deletion of 418 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break in parental strain N2. Heterozygotes are wild-type GFP+ mKate2+, and segregate wild-type GFP+ mKate2+, lethal GFP+ non-mKate2 (ve547 homozygotes), sterile Dpy non-GFP mKate2+ (mT1 homozygotes), and large numbers of arrested aneuploid embryos. Maintain by picking wild-type GFP+ mKate2+ and check for correct segregation of progeny to maintain. Left flanking Sequence: aaattaattaatttataatgtgatcctttt ; Right flanking sequence: agtcgtagacgattttcgattttcactgta. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation."

Proper citation: RRID:WB-STRAIN:WBStrain00047453 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047455

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: K07E1.1(ve549[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 979 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: tattttctcctgctttcagttttgatttcc ; Right flanking sequence: ccatctgtcttgtaaatagagctctcttca. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047455 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047456

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: T01D1.4(ve550[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1770 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: ttgtctgatgtagaagtttagttgttgtgg ; Right flanking sequence: TGTGGGAGACGACGATCTCCGCATGGGAAT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047456 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047457

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: decr-1.3(ve551[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) II.
Notes: Homozygous viable. Deletion of 1260 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCTTCCACGAATAACGTTCTCAACATCTCC ; Right flanking sequence: cgtggaacaccctttttaatctttaaactt. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047457 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047459

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001404(fbp-1)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00001404(fbp-1), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: fbp-1(ve553[LoxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + LoxP]) I.
Notes: Homozygous viable. Deletion of 4852 bp with Calarco/Colaiacovo selection cassette conferring myo-2 GFP and G418 resistance inserted at break. Left flanking Sequence: TCCTCGACGTCGAGTTTCGATCCGAGAATG ; Right flanking sequence: CCATttctgtaagaatttattgaattttga. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: RG KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047459 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047548

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: C50D2.5(gk3741[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 425 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTCCCTGTGGAATTTCGGAGTGTCGTTGGC; Right flanking sequence: TGGTGCTCTATTATCAAGCGACAAAAGCGT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047548 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047541

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00010982(flp-32)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00010982(flp-32)
Availability: unknown
References:
Synonyms: flp-32(gk3692[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Notes: Homozygous viable. Deletion of 284 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAATGCGATTGCTGCTTCATTTGTTATTCG; Right flanking sequence: TGGAAGCCATGCCAAGGTGAGTGGAAGTGA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047541 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047543

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: W04C9.5(gk3705[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 855 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCCACATGGTGACCTAGGTTTACAGGTGGT; Right flanking sequence: AGGTATGCAACAACGCTCCATTGCTAATTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047543 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047544

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: EEED8.12(gk3721[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 264 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAATTGTAGAGTTAAAATCTACATTTCCA; Right flanking sequence: CAGAAGGGAAACCATAAATAACGATGAAAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047544 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047546

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00002206(kin-24)|WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00002206(kin-24), WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: kin-24(gk3724[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 978 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCAACATCACCGACTCGCGTGCAAAATCCG; Right flanking sequence: GGTTCCAGCAATGCAGGCTGTTCTCAGTTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047546 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047551

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00016958(ilys-4)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00016958(ilys-4)
Availability: unknown
References:
Synonyms: ilys-4(gk3827[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP])/nT1 IV; +/nT1 V.
Notes: Homozygous lethal or sterile deletion balanced by nT1. Deletion of 692 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Pick viable fertile GFP+ animals to maintain; homozygous nT1 is non-GFP vulvaless hermaphrodite that bags. Left flanking sequence: CTTAATTTTTTAGTGGAAGACGATCATCCA; Right flanking sequence: GGGAACAATTGGATATTGGAAAAGAGTTCG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047551 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047552

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: C48B6.3(gk5054[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 801 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CGAGCTGTTCTTCGAGAACTGGCGGTGCCC; Right flanking sequence: AAATAACTCAACGACATCTCCAACGTCACA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047552 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047553

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: igeg-1(gk5079[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 1917 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAATTGGAGAGAGCAGTGGACAGAGGT; Right flanking sequence: TGAGGGGAATACGCCAGGTTTCGCCAGGAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047553 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047554

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)|WBGene00008093(lron-1)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54), WBGene00008093(lron-1)
Availability: unknown
References:
Synonyms: lron-1(gk5081[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) X.
Notes: Homozygous viable. Deletion of 3289 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TGATCACTCATTTCCTTATTCTTTCCAGGT; Right flanking sequence: TTTGGTTTCCTATCCCTTTTCAACAAATTC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047554 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047537

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: F11A5.3(gk3668[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Notes: Homozygous viable. Deletion of 370 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTGTGTGTATGTATGTAGATCAGTGTTCC; Right flanking sequence: CGGAAAGTCTAATCTATTGCTGCGATTCAC. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047537 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047539

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: T26C12.3(gk3686[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 569 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TAAATCGACCAATTCCTCGAATGGGAATCT; Right flanking sequence: CGGATCCAAGAAGGATATGAGAGTCAAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047539 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047592

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: Y57G11B.2(gk5309[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) IV.
Notes: Homozygous viable. Deletion of 2052 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: AGTTAATCTGAAAAGCAACACTAGAAACCA; Right flanking sequence: GGGTTCAAATCAATTATTTCTGTAATTTAA. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047592 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047594

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: K02E11.4(gk5314[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) V.
Notes: Homozygous viable. Deletion of 1078 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TTGAAGTACGACAGAAAGCTGCTGATGTGC; Right flanking sequence: AAAGGGTTACTACACAATTGTTCAAACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047594 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047626

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004372(rig-5)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004372(rig-5), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: rig-5(gk5383[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) I.
Notes: Homozygous viable. Deletion of 8834 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: CTGGCTGAATCCACTTGAATTGCTCGGAGC; Right flanking sequence: GTAATAGCGACGATTGAGCAATGAAGAGAG. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047626 Copy   

http://www.wormbase.org/db/get?name=WBStrain00047627

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00003514(myo-2)|WBGene00004496(rps-27)|WBGene00006789(unc-54)
Genomic Alteration: WBGene00003514(myo-2), WBGene00004496(rps-27), WBGene00006789(unc-54)
Availability: unknown
References:
Synonyms: C32D5.6(gk5390[loxP + myo-2p::GFP::unc-54 3' UTR + rps-27p::neoR::unc-54 3' UTR + loxP]) II.
Notes: Homozygous viable. Deletion of 1833 bp with Calarco/Colaiacovo selection cassette conferring myo-2::GFP and G418 resistance inserted at break. Left flanking sequence: TCTACATCATCGGTGTTCGACATCCCATTG; Right flanking sequence: AAATTTGAAAAAAAAAACTACAATGACTTT. Please reference Au et al., G3 9(1): 135-144 2019 in any work resulting from use of this mutation.|"Made_by: Vancouver KO Group"

Proper citation: RRID:WB-STRAIN:WBStrain00047627 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch