Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search
Reset search
On page 5 showing 81 ~ 100 out of 122,502 results
Snippet view Table view Download Top 1000 Results

Can't find the RRID you're searching for? X
Click the to add this resource to a Collection

http://www.wormbase.org/db/get?name=WBStrain00054605

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054605 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054566

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: inx-14(ag17); zwIs142[Psra-11::GFP]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054566 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054567

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: acc-2(ok2216); kyEx3801[Psra-11::ChR2::GFP, Punc-122::dsRed]; zwEx277[Pflp-18::loxP::LacZ::STOP::loxP::acc-2(cDNA), Pflp-18::lox-P::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054567 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054569

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: zwEx287[Punc-171::: inx-12ss, Punc-171:: inx-12as]; zwIs142[Psra-11::GFP]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054569 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054602

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: srh-195(yum2500) II; srh-185(yum2493) srh-186(yum2494) srh-187(yum2495) srh-190(yum2496) srh-192(yum2497) srh-193(yum2498) srh-194(yum2499) srh-199(yum2501) V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054602 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054607

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054607 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054608

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: srh-146(yum2719) srh-147(yum2720) srh-148(yum2721) srh-149(yum2722) srh-154(yum2723) srh-159(yum2724) srh-166(yum2716) srh-167(yum2717) srh-169(yum2718) srh-174(yum2729) srh-177(yum2730) srh-178(yum2731) srh-179(yum2732) srh-180(yum2733) srh-183(yum2736) V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054608 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054609

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: srh-288(yum2617) srh-289(yum2618) srh-290(yum2619) V
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054609 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054551

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: csr-1(fj160); CeRep55 quadruple deletions (fj115, fj85, fj123, and fj120) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054551 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054553

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: csr-1(fj163fj150) CeRep55 quadruple deletions (fj115, fj85, fj123, and fj120) X
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054553 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054550

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001860(him-1)
Genomic Alteration: WBGene00001860(him-1)
Availability: unknown
References:
Synonyms: him-1(e879) I; fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: The CeRep55_X quadruple-deletion mutant does not exhibit a clear Him phenotype, but the Him phenotype of the him-1(e879) mutant is enhanced by the CeRep55_X quadruple deletions. CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. The e879 mutation can be checked by PCR with the following primers: AAATCAGGAGTGGGCATCAG and GGGAAGATTCCGATGAGTGA, followed by digestion with MvaI. The wild-type him-1 gene contains an MvaI site within its PCR region, while the e879 allele does not. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054550 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054555

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: lgc-49(tm6556); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054555 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054556

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: acc-3(ok3450); zwEx175[Pflp-18::loxP::LacZ::STOP::loxP::mCherry::SL2::GFP, Pgpa-14::Cre]
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054556 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054540

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: cec-4(ok3124) him-8(e1489) IV
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054540 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054541

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: cec-5(tm6207) him-8(e1489) IV
Notes: EMPTY

Proper citation: RRID:WB-STRAIN:WBStrain00054541 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054542

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00017990(cec-4)|WBGene00017993(cec-5)|WBGene00021913(cec-8)
Genomic Alteration: WBGene00017990(cec-4), WBGene00017993(cec-5), WBGene00021913(cec-8)
Availability: unknown
References:
Synonyms: cec-8(fj63) III; cec-4(ok3124) cec-5(fj58) IV.
Notes: Maintain at 20C or lower. cec-8; cec-4 cec-5 triple mutants exhibit partial sterility and no significant defects in chromosome segregation. The chromodomain proteins CEC-5, CEC-4, and CEC-8 are phylogenetically similar to each other. The deletions can be detected by PCR with the following primers: cec-8(fj63): GCTGTATAATACTCACTATGTC and TCCAGCTCTGTAACCTTGAA; cec-4(ok3124): CAATTAAAATGCCAGTGCGA and TTTAGGATGCATTATGGGGC; cec-5(fj58): GCAAAGAAATCATCCGGTAGTG and CTTTGTAGCAACAGGCTCCTC. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054542 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054548

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00012802(set-25)|WBGene00019883(met-2)
Genomic Alteration: WBGene00012802(set-25), WBGene00019883(met-2)
Availability: unknown
References:
Synonyms: met-2(ok2307) set-25(n5021) III.
Notes: Maintain at 20C or lower. The met-2 set-25 double mutant exhibits partial sterility and no significant defects in chromosome segregation. MET-2 and SET-25 are the methyltransferases responsible for histone H3K9me2 and H3K9me3. The deletion mutations can be checked by PCR with the following primers: met-2(ok2307), GGTTGATGCGGAGAAGACTG and AATGGATTCGGTGCTTCGTG; set-25(n5021), GAGCCCGTGCCACAGAGTAG and CCTAGAGCGATGTCCTTGATGG. This strain was used as a negative control in the immunodetection of H3K9me2.

Proper citation: RRID:WB-STRAIN:WBStrain00054548 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054545

Source Database: WormBase (WB)
Genetic Background:
Affected Genes:
Genomic Alteration:
Availability: unknown
References:
Synonyms: fjDf1 fjDf2 fjDf3 fjDf4 X.
Notes: CeRep55 quadruple deletion: fjDf1 (also known as fj115); fjDf2 (aka fj85); fjDf3 (aka fj123); fjDf4 (aka fj120) X. This strain lacks four major clusters of CeRep55 repeats on the X chromosome. The condensation of unpaired X chromosomes in male testes is insufficient. CeRep55 is a class of minisatellite sequences consisting of a 27-nt tandem repeat that is present on all chromosomes. Some CeRep55 clusters express long non-coding RNAs and small RNAs. Each of the four deletion sites was designed to acquire a sequence tag (TGTACAGGAAACAGCTATGACC; similar to M13 reverse) instead of the CeRep55 tandem repeats. The deletions of CeRep55 clusters can be checked by PCR with the following primers: fjDf1 in Y73B3A, CAACCTGACTCTCGCCAAGAC and GGAGAAGTAGGCGTGTCAGTTA; fjDf2 in Y75D11A, CAAGTGCCAAACTAGACTGCTC and TTCAAAACGCTACGCGATACCAG; fjDf3 in Y81B9A, AAATGCCCCTATCTCACAGTGG and GACTGCTAGAATCTGACTCGTC; fjDf4 in Y49A10A, CTCTTCCATTTCCAGTACAACCAG and GTTTCTATGGCTAGAGTCGTATGGTTAC. The PCR check can also be performed with the M13 reverse primer and the right-side primer. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054545 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054547

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00007297(vsra-1)|WBGene00017641(csr-1)
Genomic Alteration: WBGene00007297(vsra-1), WBGene00017641(csr-1)
Availability: unknown
References:
Synonyms: vsra-1(tm1637) I; csr-1(fj54)/tmC5 [F36H1.3(tmIs1220)] IV.
Notes: Sterile csr-1 allele balanced over tmC5 labelled with Venus. Heterozygotes are wild-type with somewhat dimmer Venus signal and segregate WT Venus(+) heterozygotes, Mec Unc Venus(+) tmC5 homozygotes, and non-Venus csr-1(fj54) homozygotes (sterile, but some animals lay a small number of dead eggs). Pick wild-type Venus(+) and check for proper segregation of progeny to maintain. Homologous pairing and unpaired silencing of meiotic chromosomes are inaccurate in homozygous tm1637; fj54 double mutants. The vsra-1 mutation enhances the defects caused by the csr-1 mutation. The fj54 deletion causes a frame-shift to stop the translation of both PAZ and Piwi domains. tm1637 can be detected by PCR with the following primers: AAGCAGTTCTTCAAGACTGGTC and TTGTCCACTCGCACTTTGTG. The fj54 deletion can be checked by PCR with the following primers: AAGAAATACCAATGCGGAGGCA and TTCACGGCTCTTTGCAGTTTCA. vsra-1 is also known as csr-2/C04F12.1. Reference: Tabara H, et al. (2023) A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes. EMBO J, e105002.

Proper citation: RRID:WB-STRAIN:WBStrain00054547 Copy   

http://www.wormbase.org/db/get?name=WBStrain00054646

Source Database: WormBase (WB)
Genetic Background:
Affected Genes: WBGene00001804(gur-3)
Genomic Alteration: WBGene00001804(gur-3)
Availability: unknown
References:
Synonyms: gur-3(ok2245) X; wtfIs5.
Notes: wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons in a gur-3(ok2245) mutant background. Derived from parental strain AML14 by integration of wtfEx4. Reference: Gauthey W, et al. Curr Biol. 2024 Jan 8;34(1):R14-R15. doi: 10.1016/j.cub.2023.10.043. PMID: 38194919.|"wtfIs5 [rab-3p::NLS::GCaMP6s + rab-3p::NLS::tagRFP]. Integrated calcium indicator GCaMP6s and calcium-insensitive fluorescent protein RFP in the nuclei of all neurons. Derived from AML14 by integration of wtfEx4. Reference: Nguyen JP, et al. PLoS Comput Biol. 2017 May 18;13(5):e1005517."

Proper citation: RRID:WB-STRAIN:WBStrain00054646 Copy   

Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X

  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search

  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X

About

Welcome to the Resource Identification Portal Community.

Please see Force11 for more detailed information

We thank the NIH for their support of the RRID portal Award# R24GM144308, U24DK097771, U24DA039832, HHSN276201700124P, 75N97021P00135

Recent News Entries

Contact Us

Our Information

rii-help *at* scicrunch.org

About SciCrunch | Privacy Policy | Terms of Service

SciCrunch