Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13825143
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 1-bp substitution and premature stop codon in exon 2 of rat Gja5 gene of WKY/NCrl rat embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_13825143 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394616
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This wild type strain was produced by crossing Tph2em3Mcwi heterozygous rats and confirmed by sequencing. The Tph2em3Mcwi heterozygous mutant was created by injecting ZFNs targeting the sequence CATGGCTCCGACCCCctctacACCCCGGAACCG into DA/OlaHsd rat embryos. The resulting mutation is a 11-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_14394616 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=13792808
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Ptk2b gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp deletion in exon 2.
Proper citation: RRID:RGD_13792808 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=25394528
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Crl:SD rat embryos. The resulting mutation is a a 23-bp deletion in exon 3. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_25394528 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14398481
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 12-bp deletion in exon 4 of rat Xdh gene in the SS/JrHsdMcwi embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_14398481 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394491
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 4-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_14394491 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=14394488
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a 10-bp deletion in exon 2 of the Glp1r gene in Lew/NCrl embryos. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_14394488 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054408
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a mutation in the Kcnj10 gene of SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp insertion in the Kcnj10 gene. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_10054408 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10054417
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: CRISPR/Cas9 system was used to introduce a delins sequence alteration in the Mmp9 gene of SS/JrHsdMcwi rat embryos. The mutation is a 1-bp (t) deletion and a 5-bp (cgggta) insertion in in exon 4, which causes frameshift of the coded protein and premature stop codon in exon 8. Contact MCW rat distribution at mcwcustomrats@mcw.edu
Proper citation: RRID:RGD_10054417 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131922
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCACCCTGTGCGTCctgctgTCCCAGGTAGGGAATG into SS/JrHsdMcwi rat embryos. The resulting mutation is an 8-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131922 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139873
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 17-bp frameshift deletion in exon1.
Proper citation: RRID:RGD_4139873 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139878
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence aaccacaaccaactacgatgatgaccggaagtggggc into SS/JrHsdMcwi rat embryos. The resulting mutation is a 8-bp frameshift deletion in exon 7.
Proper citation: RRID:RGD_4139878 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139882
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence gcctccgcaggccctgagcgagcagaccgatgaagcgggg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 22-bp frameshift deletion in exon 2.
Proper citation: RRID:RGD_4139882 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139884
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence gtctactgcccaaggaatgtgaccgtggagtggca into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon1.
Proper citation: RRID:RGD_4139884 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131933
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CGAGTGGGCCATgtgggCCAACGAACAGGCGC into SS/JrHsdMcwi rat embryos. The resulting mutation is a 36-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_5131933 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6484564
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTCGCCTGCATCCTTCAAGtgcagtTCCCAGGAGCAGGTAAGG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 13-bp frameshift deletion in exon 1.
Proper citation: RRID:RGD_6484564 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509994
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNS targeting the sequence ctcccccatcccacttgaatgtggagcagcctgtg into SS/JrHsdMcwi rat embryos. The resulting mutation is a 1-bp deletion in exon 7 in SS/JrHsdMcwi.
Proper citation: RRID:RGD_5509994 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509988
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence TTCCCAATTCGTCACAgaagctGCTGGAGCTGATAAG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 138-bp deletion of part of intron 1 and exon 2.
Proper citation: RRID:RGD_5509988 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5131952
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CCTGGGGACTTCACACCCACccattcCCATAGTGCACTGGGT into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 4.
Proper citation: RRID:RGD_5131952 Copy
https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6483453
Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Cryopreserved Sperm (as of 2021-11-03)
References:
Synonyms:
Notes: This allele was made by ZFN mutagenesis. The resulting mutation is a 37-bp frameshift deletion in exon 1 (del 74-110)
Proper citation: RRID:RGD_6483453 Copy
Can't find your Organism?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
