Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Integrated Animals is a virtual database currently indexing available animal strains and mutants from: AGSC (Ambystoma), BCBC (mice), BDSC (flies), European Xenopus Resource Center (frog), The National Xenopus Resource (frog), Xenopus Express (frog), CWRU Cystic Fibrosis Mouse Models (mice), DGGR (flies), FlyBase (flies), IMSR (mice), MGI (mice), MMRRC (mice), NSRRC (pig), RGD (rats), Sperm Stem Cell Libraries for Biological Research (rats), Tetrahymena Stock Center (Tetrahymena), WormBase (worms), XGSC (Xiphophorus), ZFIN (zebrafish), and ZIRC (zebrafish). Note, the IMSR data is linked, but users may need to re-execute the search if the top mouse is not returned properly.
Note: BCBC is no longer in service, so the links may not be functional.

Suggested Search Criteria

Enter extra filters to help narrow your search

Search

Type in a keyword to search

On page 2 showing 21 ~ 40 out of 64 results
Snippet view Table view Download 64 Result(s)
Click the to add this resource to a Collection
  • RRID:RGD_728198

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728198

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: To N in 1979 from Flow Laboratories. Closed colony since then. BHE was started in 1942 by the Agricultural Research Service. USDA from a cross between a black and white hooded strain from Pennsylvania State College and an albino Os- borne-Mendel (also called the Yale strain) strain from Columbia University.

Proper citation: RRID:RGD_728198 Copy   


  • RRID:RGD_728187

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728187

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Strain originated from Curtiss and Dunning 1926 at the Columbia University Institute for Cancer Research. To Heston 1945 at F30, to National Institutes of Health 1950 at F41. Subsequent sublines from Dunning or NIH.

Proper citation: RRID:RGD_728187 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=631282

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This speed congenic strain contains an F344 chromsome 10 segment transferred to a DA background.

Proper citation: RRID:RGD_631282 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=1566445

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This congenic strain contains a region of BN/SsNHsd chromosome 5 transferred to the ACI/SegHsd strain background

Proper citation: RRID:RGD_1566445 Copy   


  • RRID:RGD_737657

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=737657

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Originally derived by Dr. Hans J. Hedrich at Versuchstierzucht, Hannover, Germany by transgressing the MHC of DA/Han rats (AV1) into LEW/Han rats for 16 backcross generations. RT1av1 haplotype is a variant to the standard a- haplotype with the difference residing in the atypical MHC class I region.

Proper citation: RRID:RGD_737657 Copy   


  • RRID:RGD_728196

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=728196

Source Database: Rat Genome Database (RGD)
Genetic Background: congenic
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Heterozygous Gunn rats were mated with RHA/N the heterzygous offsprings of this and each following generation was backcrossed with RHA/N to get these congenics.

Proper citation: RRID:RGD_728196 Copy   


  • RRID:RGD_60986

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=60986

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Heston 1946 from Buffalo stock of H. Morris. To NIH in 1950 at F10. NIH Autoimmune Rat Model Repository and Development Center

Proper citation: RRID:RGD_60986 Copy   


  • RRID:RGD_60987

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=60987

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Milan Hypertensive Strain: Outbred Wistar rats with brother x sister mating and selection for high systolic blood pressure (Bianchi et al 1974, Barber et al, 1994).

Proper citation: RRID:RGD_60987 Copy   


  • RRID:RGD_61011

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=61011

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: Mutation causing diabetes mellitus in a closed colony of outbred Wistar rats at Bio-Breeding Labs, Ontario, Canada in 1974 (Chappel and Chappel 1983). To Worcester in 1977 where inbreeding began. Sublines of diabetic-prone and diabetic-resistant animals have been developed, and there are also subline differences in the incidence, age of onset, untreated survival time of diabetes, leucopenia and body weight gain which can be attributed to genetic factors (Kloting et al 1987). A detailed study of 24 inbred and two outbred lines of diabetes-prone and diabetes resistant BB rats using eight marker loci found substantial genetic variation among and some variation within some of the colonies. The 22 colonies which were apparently isogenic could be divided into four groups on the basis of the marker loci (Prins et al 1990).

Proper citation: RRID:RGD_61011 Copy   


  • RRID:RGD_10026

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=10026

Source Database: Rat Genome Database (RGD)
Genetic Background: inbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: To N 1964 at F18+? from Maas. Developed by Broadhurst, 1954, from a commercial stock, with selection for low defecation response in an open field. A number of parallel sublines are in existence; these differ at least at the agouti and the major histocompatibility loci.

Proper citation: RRID:RGD_10026 Copy   


  • RRID:RRRC_00239

    This resource has 10+ mentions.

http://rgd.mcw.edu/tools/strains/strains_view.cgi?id=728193

Source Database: Rat Resource and Research Center (RRRC)
Genetic Background: outbred
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: To N 1945 from Sprague Dawley, Inc. Colony closed since then. NIH Autoimmune Rat Model Repository and Development Center, Rat Resource and Research Center

Proper citation: RRID:RRRC_00239 Copy   


  • RRID:RGD_4139879

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=4139879

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS/JrHsdMcwi rat embryos. The resulting mutation is a 10-bp frameshift deletion in exon 6.

Proper citation: RRID:RGD_4139879 Copy   


  • RRID:RGD_5508371

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5508371

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence GCCCCAGCCATGCTGTGCtatgtGACGAGGCCGGACGCGGTG into SS/JrHsdMcwi rat embryos. The resulting mutation is a 51-bp frameshift deletion in exon 1.

Proper citation: RRID:RGD_5508371 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5509997

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence ctctgaaccttcaactttcagatactgatgacaatgaa into SS.BN-(D13Rat20-D13Got22)/Mcwi rat embryos. The resulting mutation is an 11-bp frameshift deletion in exon 6.

Proper citation: RRID:RGD_5509997 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687974

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence CTGCTCTATGACCCTGACTatgtgAAGGTGGTTCTGGGAAGAT into SS-Chr 5BN/Mcwi strain rat embryos. The resulting mutation is a 2-bp framesnift deletion in exon 2.

Proper citation: RRID:RGD_5687974 Copy   


  • RRID:RGD_5687992

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687992

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5687992 Copy   


  • RRID:RGD_5687987

https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5687987

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5687987 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688006

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688006 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=5688002

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: ZFN mutant founders were backcrossed with SS/JrHsdMcwi to get heterozygous offsprings which were intercrossed and offsprings maintained as homozygous and heterozygous breeders.

Proper citation: RRID:RGD_5688002 Copy   


https://rgd.mcw.edu/rgdweb/report/strain/main.html?id=6893437

Source Database: Rat Genome Database (RGD)
Genetic Background: mutant
Affected Genes:
Genomic Alteration:
Availability: Extinct
References:
Synonyms:
Notes: This strain was produced by injecting ZFNs targeting the sequence AGCTTCATACAGCGGCtccatgTTGCAGGGGATGGAAGTC into BBDR.BBDP-(D4Mit6-D4Mit7)/RhwMcwi rat embryos. The resulting mutation is a 13-bp deletion in exon 5.

Proper citation: RRID:RGD_6893437 Copy   



Can't find your Organism?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific organism, it's easier to enter an RRID or a Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your organism in the search results, please help us by registering it into the system — it's easy. Organisms identifiers are registered through multiple sources depending on the species:

Can't find the RRID you're searching for? X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Save Your Search

    You can save any searches you perform for quick access to later from here.

  6. Query Expansion

    We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.

  7. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  8. Sources

    Here are the sources that were queried against in your search that you can investigate further.

  9. Categories

    Here are the categories present within RRID that you can filter your data on

  10. Subcategories

    Here are the subcategories present within this category that you can filter your data on

  11. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.

X