Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: mariner transposon flanked by MmeI modified inverted repeats and the himar1C9 transposase
Vector Backbone Description: Vector Backbone:pSAM; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: The Plac promoter from pGFP-Mut3.1 (Clonetech), along with its associated ribosome binding sequence, was amplified via PCR. Engineered 59 BamHI and 39 NdeI restriction sites were used to sub-clone the resulting fragment into a BamHI/NdeI (New England Biolabs) double digested pSAM_Bt vector upstream of the himar1C9 transposase gene. The kanamycin resistance gene from pKD4 was amplified and ligated using the restriction sites MfeI and XbaI, replacing the erythromycin resistance gene ermG in pSAM_Bt. The resulting transposon mutagenesis vector, pSAM-Ec, was stored and propagated in the pir+ E. coli strain EcS17.
Proper citation: RRID:Addgene_102939 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-125b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103191 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7f-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103156 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-101-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103165 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-105-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103169 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103146 Copy
Species: Saccharomyces cerevisiae
Genetic Insert: Hsp104
Vector Backbone Description: Backbone Size:0; Vector Backbone:pJC45S; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_1248 Copy
Species: Rattus norvegicus
Genetic Insert: rat IgG2a Hinge-G4S-Sortag-Histag
Vector Backbone Description: Backbone Marker:Thermo Fisher; Backbone Size:3956; Vector Backbone:pCR4 TOPO TA; Vector Types:Bacterial Expression, CRISPR, Other, HDR template; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_124810 Copy
Species: Danio rerio
Genetic Insert: ApoA4a
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCRII; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_121902 Copy
Species: Danio rerio
Genetic Insert: ApoBa
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCRII; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_121897 Copy
Species: Danio rerio
Genetic Insert: ApoBb.1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3931; Vector Backbone:pCRII; Vector Types:Unspecified; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_121898 Copy
Species: Synthetic
Genetic Insert: CMV-OsTIR1-loxP-PURO-loxP
Vector Backbone Description: Vector Backbone:pBluescript; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: This plasmid is a variant of Addgene plasmid 72834.
Proper citation: RRID:Addgene_121184 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pCR2.1; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_126577 Copy
Species: Mus musculus
Genetic Insert: mouse Ins2 gene partial
Vector Backbone Description: Backbone Marker:Life Technologies; Vector Backbone:pCR2.1-TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_53969 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_111873 Copy
Species:
Genetic Insert: Lifeact fused to mCherry
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_111876 Copy
Species:
Genetic Insert: mCherry
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_111874 Copy
Species: Other
Genetic Insert: Capsaspora N-Myristoylation motif (CoNMM) from the Src2 gene fused to mCherry
Vector Backbone Description: Backbone Size:5127; Vector Backbone:pONSY; Vector Types:Other, Capsaspora owczarzaki; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_111878 Copy
Species: Other
Genetic Insert: uracil phosphoribosyltransferase
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pCR4/TOPO; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Selection for kanamycin resistance after introduction of pMO746 identifies those cells in which integration into the chromosome of part or all of the plasmid has occurred.
Kanamycin resistance is a strong selection in the sulfate-reducing bacteria (SRB). Ampicillin is not universally effective in the SRB but is often used for selection in Escherichia coli. Thus this plasmid can be readily grown in E. coli but is actually unstable in the SRB.
Proper citation: RRID:Addgene_117480 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pPMQAK1; Vector Types:Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/426700v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_119559 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.