Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113238 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113185 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113189 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113178 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113177 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113175 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113179 Copy
Species: Other
Genetic Insert: Cas1
Vector Backbone Description: Backbone Size:4000; Vector Backbone:pCDF1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_113180 Copy
Species: Synthetic
Genetic Insert: 24X601-MA1_2
Vector Backbone Description: Vector Backbone:pENTR223; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_114362 Copy
Species: Synthetic
Genetic Insert: 24X601-MA1_2
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_114361 Copy
Species: Synthetic
Genetic Insert: 12X601-MA2
Vector Backbone Description: Vector Backbone:pBS; Vector Types:Mammalian Expression, Unspecified; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_114359 Copy
Species: Other
Genetic Insert: disaggregase ClpGgi with 6xHis-tag
Vector Backbone Description: Backbone Size:6055; Vector Backbone:pJN105; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments: conditional Biosafety Level 2 if expressed in Pseudomonas aeruginosa SG17M
Proper citation: RRID:Addgene_126503 Copy
Species:
Genetic Insert: pGH3.17::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170844 Copy
Species:
Genetic Insert: pUBQ10::SMT2-FLAG::tOCS
Vector Backbone Description: Vector Backbone:pFP100; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170842 Copy
Species:
Genetic Insert: pFRO6::SMT2-FLAG
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please note that the Addgene verified sequence differs from the depositor reference sequence linked in the supplemental documents section. These differences did not impact plasmid function. The primers 5' - ATCCAAGCTCAAGCTAAGCTcgatgctctcaaggccaa and 3' -TATCTCATTAAAGCAGGATCCTCACTTGTCATCGTCGTCCTTGTAATCAGAACTCTCCTCCGGT were previously used, although the 5' primer differs slightly from the Addgene verified sequence.
Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170843 Copy
Species:
Genetic Insert: GH3.17p
Vector Backbone Description: Vector Backbone:pYI001; Vector Types:Plant Expression; Bacterial Resistance:Streptomycin
References:
Comments: Please visit https://doi.org/10.1101/2021.06.16.448628 for bioRxiv preprint.
Proper citation: RRID:Addgene_170841 Copy
Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_52259 Copy
Species: Homo sapiens
Genetic Insert: SUMO-3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_52260 Copy
Species: Homo sapiens
Genetic Insert: SUMO-2
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3781; Vector Backbone:pCDFDuet-1; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_52262 Copy
Species: Other
Genetic Insert: PfAgo
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:3621; Vector Backbone:pCDF-1b; Vector Types:Bacterial Expression; Bacterial Resistance:Streptomycin
References:
Comments:
Proper citation: RRID:Addgene_101723 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.