Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:4600000; Vector Backbone:E. coli K-12 MG1655 genome; Vector Types:; Bacterial Resistance:None
References:
Comments: This strain carries the DE3 lysogen.
Proper citation: RRID:Addgene_61440 Copy
Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + PLlacO-1::T710::cfp intergrated at intS
Proper citation: RRID:Addgene_61160 Copy
Species:
Genetic Insert: See comments
Vector Backbone Description: Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments: MG1655 + PLlacO-1::T710::yfp intergrated at arpB + ∆lacI
Proper citation: RRID:Addgene_61164 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔlamB ΔompF
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102264 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA ΔlamB
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102260 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA ΔompC
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102261 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompA ΔompC ΔompF
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102268 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔlamB ΔompC ΔompF
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102269 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompC
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102258 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype = ΔompF
Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte]
Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene
Proper citation: RRID:Addgene_102259 Copy
Species: Other
Genetic Insert: This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Derivative of BL21(DE3) with no specific assignment of the UAG codon
- 95 endogenous TAG codons mutated to TAA
- RF1 (prfA) deleted and fabR spontaneously mutated
- serB deleted for phosphoserine genetic code expansion expression applications
Primers for verification:
- for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG
- for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG
This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein
- Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest).
Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672
Proper citation: RRID:Addgene_197655 Copy
Species: Other
Genetic Insert: Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY
Vector Backbone Description: Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None
References:
Comments: Primer to check deletions:
ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG)
Proper citation: RRID:Addgene_200838 Copy
Species: Other
Genetic Insert: ΔtnaA ΔtrpR
Vector Backbone Description: Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None
References:
Comments: Primers for PCR verification:
veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG
veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC
veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG
veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG
Proper citation: RRID:Addgene_205015 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69773 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69783 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69780 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_69784 Copy
Species: Other
Genetic Insert: none
Vector Backbone Description: Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None
References:
Comments:
Proper citation: RRID:Addgene_52942 Copy
Species:
Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments: Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional).
Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620.
Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol.
Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1.
Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215355 Copy
Species:
Genetic Insert: na
Vector Backbone Description: Vector Backbone:na; Vector Types:; Bacterial Resistance:None
References:
Comments: This is the NC1 strain (Addgene #215355) with a deletion of the camR gene.
Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional).
Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8.
Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1.
Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215356 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
