Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
E. coli K-12 MG1655 RARE Resource Report Resource Website 1+ mentions |
RRID:Addgene_61440 | None | PMID:25076127 | This strain carries the DE3 lysogen. | Backbone Size:4600000; Vector Backbone:E. coli K-12 MG1655 genome; Vector Types:; Bacterial Resistance:None | 2023-04-14 01:07:37 | 2 | |||
|
HL 1745 Resource Report Resource Website |
RRID:Addgene_61160 | See comments | None | PMID:22833608 | MG1655 + PLlacO-1::T710::cfp intergrated at intS | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-04-14 01:07:36 | 0 | ||
|
HL 5220 Resource Report Resource Website |
RRID:Addgene_61164 | See comments | None | PMID:22833608 | MG1655 + PLlacO-1::T710::yfp intergrated at arpB + ∆lacI | Vector Backbone:N/A; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-04-14 01:07:36 | 0 | ||
|
BL21ΔBF Resource Report Resource Website |
RRID:Addgene_102264 | None | PMID:29164072 | Genotype = ΔlamB ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
BL21ΔAB Resource Report Resource Website |
RRID:Addgene_102260 | None | PMID:29164072 | Genotype = ΔompA ΔlamB Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
BL21ΔAC Resource Report Resource Website |
RRID:Addgene_102261 | None | PMID:29164072 | Genotype = ΔompA ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
BL21ΔACF Resource Report Resource Website |
RRID:Addgene_102268 | None | PMID:29164072 | Genotype = ΔompA ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
BL21ΔBCF Resource Report Resource Website |
RRID:Addgene_102269 | None | PMID:29164072 | Genotype = ΔlamB ΔompC ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
BL21ΔC Resource Report Resource Website |
RRID:Addgene_102258 | None | PMID:29164072 | Genotype = ΔompC Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
BL21ΔF Resource Report Resource Website |
RRID:Addgene_102259 | None | PMID:29164072 | Genotype = ΔompF Precursor strain = BL21Gold(DE3) [genotype F- ompT hsdS(rB– mB– ) dcm+ Tetr gal λ(DE3) endA Hte] Supplemental document contains a list of genotypes and PCR primers used for verification of each knocked-out gene | Vector Backbone:none; Vector Types:; Bacterial Resistance:None | 2023-04-15 01:00:16 | 0 | |||
|
B95(DE3) ΔA ΔfabR ΔserB Resource Report Resource Website |
RRID:Addgene_197655 | This strain is a derivative of BL21(DE3) with no specific assignment of the UAG codo | Other | None | PMID:31243963 | Derivative of BL21(DE3) with no specific assignment of the UAG codon - 95 endogenous TAG codons mutated to TAA - RF1 (prfA) deleted and fabR spontaneously mutated - serB deleted for phosphoserine genetic code expansion expression applications Primers for verification: - for RF1 (prfA) deletion: AAGCCTTCTATCGTTGCCAAAC, TTATTCCTGCTCGGACAACG - for serB deletion: AGTTTTGTGCGAGCCATCTTCCACC, GTGATGGTGTTCCAGGCATGACAGG This strain is used for expressing phosphoserine-containig proteins using genetic code expansion without buildup of prematurely truncated protein - Recommended plasmids for expressing phosphorylated proteins in this strain are Addgene #173897 (pSer GCE machinery vector) and #174075/174076 (compatible p15a origin of replication plasmids expressing sfGFP proteins from a T7 promoter; sfGFP genes can be removed by restriction digest and replaced with protein-of-interest). Original B95 strain: Mukai, T., Highly reproductive Escherichia coli cells with no specific assignment to the UAG codon. Sci. Rep. 5: 9699 (2015). PMID 25982672 | Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None | 2023-05-11 01:04:03 | 0 | |
|
Z956 Resource Report Resource Website |
RRID:Addgene_200838 | Genotype: MG1655 rph+, ilvG+, ΔlacZ, ΔrapZ, ΔglmZ, ΔglmY | Other | None | PMID:36987877 | Primer to check deletions: ΔrapZ (5' check primer: GGATACCGAAGGTACTCCGG; 3' check primer: CGTAAGAGCACTTCAGCGTC); ΔglmZ (5' check primer: GTGTAGGATCAAGCTCAGG; 3' check primer: CGGACGCCTACGATTACGC); ΔglmY (5' check primer: GTCTCTTTTTAGCGACACAGTGGC; 3' check primer: GGTGTTACTCTCGTCAGACGCG) | Vector Backbone:n/a; Vector Types:Other, This is a strain, not a plasmid; Bacterial Resistance:None | rapZ, glmZ and glmY are deleted to avoid interference with plasmid-encoded genes | 2023-07-27 01:04:30 | 0 |
|
E. coli BW25113 ΔtnaA ΔtrpR Resource Report Resource Website |
RRID:Addgene_205015 | ΔtnaA ΔtrpR | Other | None | PMID:35594503 | Primers for PCR verification: veri-trpR-F: AGCAGCTTATAACGCCGGACCAGGG veri-trpR-R: TGGTCCCGTGATGTCGCGTTATAC veri-tnaA-F: CTTGTTTTAGTAAATGATGGTGCTTG veri-tnaA-R: GATCAGTCATGATGCCACCTTTAGAG | Vector Backbone:n/a; Vector Types:; Bacterial Resistance:None | 2023-08-05 01:04:35 | 0 | |
|
HL 1951 Resource Report Resource Website |
RRID:Addgene_69773 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-09-15 01:13:30 | 0 | ||||
|
HL 6779 Resource Report Resource Website |
RRID:Addgene_69783 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-09-15 01:13:30 | 0 | ||||
|
HL 6776 Resource Report Resource Website |
RRID:Addgene_69780 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-09-15 01:13:30 | 0 | ||||
|
HL 6825 Resource Report Resource Website |
RRID:Addgene_69784 | None | PMID:27084942 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-09-15 01:13:30 | 0 | ||||
|
HL 1285 Resource Report Resource Website |
RRID:Addgene_52942 | none | Other | None | PMID:25087841 | Vector Backbone:none; Vector Types:Synthetic Biology; Bacterial Resistance:None | 2023-09-15 01:11:48 | 0 | ||
|
V. natriegens NC1 Resource Report Resource Website |
RRID:Addgene_215355 | na | None | PMID: | Genotype: ATCC14048 + ∆dns + camR + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-9rfOeT70F35Li9CNjCnA?m=slm-n4lGsmu5T0KaunpiH620. Culture in LBv2 or LBv3 broth with 2ug/mL chloramphenicol. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2024-02-24 12:05:31 | 0 | ||
|
V. natriegens NC7 Resource Report Resource Website |
RRID:Addgene_215356 | na | None | PMID: | This is the NC1 strain (Addgene #215355) with a deletion of the camR gene. Genotype: ATCC14048 + ∆dns + tfoX + lacI (nonfunctional). Supporting References: Chromosome 1 sequence: https://benchling.com/s/seq-HxxOFAiNbpHxSWT82Qju?m=slm-bQ5JkVI3VTiy0fDMPYr8. Recipe for LBv2: https://www.protocols.io/view/growth-media-for-v-natriegens-kqdg349j7l25/v1. Please visit https://www.biorxiv.org/content/10.1101/2023.08.11.553013v1 for bioRxiv preprint. | Vector Backbone:na; Vector Types:; Bacterial Resistance:None | 2024-02-24 12:05:31 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
