Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: EphA2
Vector Backbone Description: Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102755 Copy
Species: Homo sapiens
Genetic Insert: c-Jun
Vector Backbone Description: Vector Backbone:pCLXSN; Vector Types:Mammalian Expression, Retroviral; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102758 Copy
Species: Homo sapiens
Genetic Insert: EPHA3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer.
Proper citation: RRID:Addgene_102752 Copy
Species: Homo sapiens
Genetic Insert: EPHA3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer.
Proper citation: RRID:Addgene_102754 Copy
Species: Homo sapiens
Genetic Insert: EPHA3
Vector Backbone Description: Backbone Marker:Invitrogen; Vector Backbone:pcDNA3.1(+)/myc-His B; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin
References:
Comments: Please note last 10 amino acids in C-terminal are omitted in these constructs. These series of EPHA3 constructs carry missense mutations found in lung and colon cancer.
Proper citation: RRID:Addgene_102739 Copy
Species: Homo sapiens
Genetic Insert: OMKSL-gRNAs-PGK-Puro
Vector Backbone Description: Vector Backbone:PB-GG-PGK-puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102894 Copy
Species: Homo sapiens
Genetic Insert: EEA-5g-OSK2M2L1-gRNAs-PGK-Puro
Vector Backbone Description: Vector Backbone:PB-GG-PGK-puro; Vector Types:Mammalian Expression, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102909 Copy
Species: Homo sapiens
Genetic Insert: MR1A cDNA
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3908; Vector Backbone:pCR2.1-TOPO; Vector Types:Other, Cloning; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102957 Copy
Species: Homo sapiens
Genetic Insert: integration of Cas9 with guide targeting GESTALT barcodes V1 to V5
Vector Backbone Description: Vector Backbone:lentiCRISPR v2 (#52961); Vector Types:Lentiviral; Bacterial Resistance:Ampicillin
References:
Comments: Derived from pX330-U6-Chimeric_BB-CBh-hSpCas9
Proper citation: RRID:Addgene_103061 Copy
Species: Homo sapiens
Genetic Insert: H2B-GCaMP6f
Vector Backbone Description: Backbone Marker:unknown; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102994 Copy
Species: Homo sapiens
Genetic Insert: Synaptophysin-GCaMP6f
Vector Backbone Description: Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_102996 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-125b-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103191 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7f-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103156 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-101-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103165 Copy
Species: Homo sapiens
Genetic Insert: hsa-miR-105-3p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103169 Copy
Species: Homo sapiens
Genetic Insert: hsa-let-7a-5p target
Vector Backbone Description: Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin
References:
Comments: Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC.
Proper citation: RRID:Addgene_103146 Copy
Species: Homo sapiens
Genetic Insert: RARRES3
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5200; Vector Backbone:pET28b; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_100724 Copy
Species: Homo sapiens
Genetic Insert: C-KDEL
Vector Backbone Description: Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin
References:
Comments: KDEL sequence at C terminal of the coding sequence cloned in position 7.
Proper citation: RRID:Addgene_100681 Copy
Species: Homo sapiens
Genetic Insert: Pim1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments:
Proper citation: RRID:Addgene_100722 Copy
Species: Homo sapiens
Genetic Insert: MTMR1
Vector Backbone Description: Backbone Marker:Novagen; Backbone Size:5900; Vector Backbone:pET28; Vector Types:Bacterial Expression; Bacterial Resistance:Kanamycin
References:
Comments: The MTMR1 construct is for structural determination and contains the PH-GRAM and PTPase domains (amino acids 95-607). PTPase activity was confirmed.
Proper citation: RRID:Addgene_100723 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
