Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Drosophila melanogaster
Genetic Insert: Adenosine deaminase acting on RNA
Vector Backbone Description: Vector Backbone:pMT; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_139686 Copy
Species: Drosophila melanogaster
Genetic Insert: Roc1b
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14823 Copy
Species: Drosophila melanogaster
Genetic Insert: Roc2
Vector Backbone Description: Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_14824 Copy
Species: Drosophila melanogaster
Genetic Insert: E2F
Vector Backbone Description: Backbone Marker:na; Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin
References:
Comments: Dros14 dE2F clone flipped at EcoRI site; XhoI digestion gives small fragment--i.e. 5' end near KpnI site; contains entire 3' UTR from Genebank sequence including polyA.
Proper citation: RRID:Addgene_14820 Copy
Species: Drosophila melanogaster
Genetic Insert: DmLSm1
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_145880 Copy
Species: Drosophila melanogaster
Genetic Insert: gRNAcore(2.1)-pU6.3
Vector Backbone Description: Backbone Size:2351; Vector Backbone:pDONR221; Vector Types:Other, PCR template vector for amplifying gRNAcore(2.1)-pU6.3 promoter fragment; used together with pAC-CR7T-gRNA2.1-nlsBFP.; Bacterial Resistance:Kanamycin
References:
Comments: For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/
Proper citation: RRID:Addgene_170516 Copy
Species: Drosophila melanogaster
Genetic Insert: gRNAcore(EF)-tRNA(Q)
Vector Backbone Description: Backbone Size:2352; Vector Backbone:pDONR221; Vector Types:Other, PCR template vector for amplifying gRNAcore(EF)-tRNA(Q) fragment; used together with pAC-U63-tgRNA-nlsBFP or pAC-U63-tgRNA-Gal80; Bacterial Resistance:Kanamycin
References:
Comments: For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/
Proper citation: RRID:Addgene_170517 Copy
Species: Drosophila melanogaster
Genetic Insert: 2xFLAG/mCherry-Msp300KASH
Vector Backbone Description: Backbone Size:9355; Vector Backbone:pUASTattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments: Plasmid first described in:
Hall H., Medina P., Cooper D.A., Escobedo S.E., Rounds J., Brennan K.J., Vincent C., Miura P., Doerge R. and Weake V.M. (2017). Transcriptome profiling of aging Drosophila photoreceptors reveals gene expression trends that correlate with visual senescence. BMC Genomics. 18(1):894. PMID: 29162050.
Proper citation: RRID:Addgene_170807 Copy
Species: Drosophila melanogaster
Genetic Insert: Fusion of vhhGPF4 (intracellular) nanobody with Nrv1 protein and mCherry fluorophor
Vector Backbone Description: Backbone Marker:Kanca, O. et.al., Raeppli: a whole-tissue labeling tool for live imaging of Drosophila development. Development (2014); Backbone Size:8900; Vector Backbone:pUASTLOTattB; Vector Types:Insect Expression, Cre/Lox; Bacterial Resistance:Ampicillin
References:
Comments: To generate a basolateral GrabFP construct that exposes the nanobody to the cytosol we started with the GrabFP-BExt plasmid. The tagBFP sequence was replaced by the vhhGFP4 sequence and the original vhhGFP4 sequence was exchanged with an mCherry coding sequence.
pUASTLOTattB vector:
Kanca, O., Caussinus, E., Denes, A. S., Percival-Smith, A. & Affolter, M. Raeppli: a
whole-tissue labeling tool for live imaging of Drosophila development.
Development 141, 472–480 (2014).
vhhGFP4 plasmid:
Saerens D, Pellis M, Loris R, Pardon E, Dumoulin M, Matagne A, Wyns L, Muyldermans S, Conrath K
J Mol Biol. 2005 Sep 23; 352(3):597-607.
mCherry: Clonetech
Proper citation: RRID:Addgene_163926 Copy
Species: Drosophila melanogaster
Genetic Insert: Y-Left-GypSy_3xp3-optimized-tdtomato-Attp-CTCF-Y-Right
Vector Backbone Description: Backbone Size:4095; Vector Backbone:piggybac; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_164153 Copy
Species: Drosophila melanogaster
Genetic Insert: Y-Left-GypSy_3xp3-optimized-tdtomato-Attp-CTCF-Y-Right
Vector Backbone Description: Backbone Size:4095; Vector Backbone:piggybac; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_164148 Copy
Species: Drosophila melanogaster
Genetic Insert: Y-Left-GypSy_3xp3-optimized-tdtomato-Attp-CTCF-Y-Right
Vector Backbone Description: Backbone Size:4095; Vector Backbone:piggybac; Vector Types:; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_164149 Copy
Species: Drosophila melanogaster
Genetic Insert: U6 and DR
Vector Backbone Description: Backbone Size:7350; Vector Backbone:white+attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_164586 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab32
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44834 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab32
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44835 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab27
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44832 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab11
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44831 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab11
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44829 Copy
Species: Drosophila melanogaster
Genetic Insert: Rab3
Vector Backbone Description: Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_44820 Copy
Species: Drosophila melanogaster
Genetic Insert: three sites partially complementary to miR-34
Vector Backbone Description: Backbone Marker:promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
References:
Comments: The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA
S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC
AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC
the triple(3x)-repeated sequence:
5'TGGCAGTGACCTTAGCATCAACAC-3'
3'ACCGTCACTGGAATCGTAGTTGTG-5'
pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion.
Proper citation: RRID:Addgene_40831 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
