Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pMT-ADARcd-E488Q-V5 Resource Report Resource Website |
RRID:Addgene_139686 | Adenosine deaminase acting on RNA | Drosophila melanogaster | Ampicillin | PMID:29127211 | Vector Backbone:pMT; Vector Types:Bacterial Expression, Insect Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:26:40 | 0 | ||
|
pRD182 (Roc1b) Resource Report Resource Website |
RRID:Addgene_14823 | Roc1b | Drosophila melanogaster | Ampicillin | PMID: | Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:27:46 | 0 | ||
|
pRD183 (Roc2) Resource Report Resource Website |
RRID:Addgene_14824 | Roc2 | Drosophila melanogaster | Ampicillin | PMID: | Backbone Marker:Promega; Backbone Size:2600; Vector Backbone:T7 IVT; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:27:46 | 0 | ||
|
pRD60 (dE2F) Resource Report Resource Website |
RRID:Addgene_14820 | E2F | Drosophila melanogaster | Ampicillin | PMID: | Dros14 dE2F clone flipped at EcoRI site; XhoI digestion gives small fragment--i.e. 5' end near KpnI site; contains entire 3' UTR from Genebank sequence including polyA. | Backbone Marker:na; Backbone Size:0; Vector Backbone:na; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:27:46 | 0 | |
|
pAc5.1B-EGFP-DmLSm1_A Resource Report Resource Website |
RRID:Addgene_145880 | DmLSm1 | Drosophila melanogaster | Ampicillin | PMID:17923697 | Vector Backbone:Unknown; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | two silent mutations compared to the sequence given by NCBI: NM_137715.3 | 2022-04-22 03:27:30 | 0 | |
|
pGC(2.1)-U6.3 Resource Report Resource Website |
RRID:Addgene_170516 | gRNAcore(2.1)-pU6.3 | Drosophila melanogaster | Kanamycin | PMID:33782117 | For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/ | Backbone Size:2351; Vector Backbone:pDONR221; Vector Types:Other, PCR template vector for amplifying gRNAcore(2.1)-pU6.3 promoter fragment; used together with pAC-CR7T-gRNA2.1-nlsBFP.; Bacterial Resistance:Kanamycin | 2022-04-22 03:32:30 | 0 | |
|
pTR(EF)-tRNA(Q) Resource Report Resource Website |
RRID:Addgene_170517 | gRNAcore(EF)-tRNA(Q) | Drosophila melanogaster | Kanamycin | PMID:33782117 | For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/ | Backbone Size:2352; Vector Backbone:pDONR221; Vector Types:Other, PCR template vector for amplifying gRNAcore(EF)-tRNA(Q) fragment; used together with pAC-U63-tgRNA-nlsBFP or pAC-U63-tgRNA-Gal80; Bacterial Resistance:Kanamycin | 2022-04-22 03:32:30 | 0 | |
|
pUASTattB-2xFlag-mCherry-Msp300KASH Resource Report Resource Website |
RRID:Addgene_170807 | 2xFLAG/mCherry-Msp300KASH | Drosophila melanogaster | Ampicillin | PMID:34022041 | Plasmid first described in: Hall H., Medina P., Cooper D.A., Escobedo S.E., Rounds J., Brennan K.J., Vincent C., Miura P., Doerge R. and Weake V.M. (2017). Transcriptome profiling of aging Drosophila photoreceptors reveals gene expression trends that correlate with visual senescence. BMC Genomics. 18(1):894. PMID: 29162050. | Backbone Size:9355; Vector Backbone:pUASTattB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:32:35 | 0 | |
|
pUASTLOTattB_mCherry::Nrv1::vhhGFP4 Resource Report Resource Website |
RRID:Addgene_163926 | Fusion of vhhGPF4 (intracellular) nanobody with Nrv1 protein and mCherry fluorophor | Drosophila melanogaster | Ampicillin | PMID:28395731 | To generate a basolateral GrabFP construct that exposes the nanobody to the cytosol we started with the GrabFP-BExt plasmid. The tagBFP sequence was replaced by the vhhGFP4 sequence and the original vhhGFP4 sequence was exchanged with an mCherry coding sequence. pUASTLOTattB vector: Kanca, O., Caussinus, E., Denes, A. S., Percival-Smith, A. & Affolter, M. Raeppli: a whole-tissue labeling tool for live imaging of Drosophila development. Development 141, 472–480 (2014). vhhGFP4 plasmid: Saerens D, Pellis M, Loris R, Pardon E, Dumoulin M, Matagne A, Wyns L, Muyldermans S, Conrath K J Mol Biol. 2005 Sep 23; 352(3):597-607. mCherry: Clonetech | Backbone Marker:Kanca, O. et.al., Raeppli: a whole-tissue labeling tool for live imaging of Drosophila development. Development (2014); Backbone Size:8900; Vector Backbone:pUASTLOTattB; Vector Types:Insect Expression, Cre/Lox; Bacterial Resistance:Ampicillin | 2022-04-22 03:31:03 | 0 | |
|
AByI Resource Report Resource Website |
RRID:Addgene_164153 | Y-Left-GypSy_3xp3-optimized-tdtomato-Attp-CTCF-Y-Right | Drosophila melanogaster | Ampicillin | PMID:30079589 | Backbone Size:4095; Vector Backbone:piggybac; Vector Types:; Bacterial Resistance:Ampicillin | 2022-04-22 03:31:08 | 0 | ||
|
AByB Resource Report Resource Website |
RRID:Addgene_164148 | Y-Left-GypSy_3xp3-optimized-tdtomato-Attp-CTCF-Y-Right | Drosophila melanogaster | Ampicillin | PMID:30079589 | Backbone Size:4095; Vector Backbone:piggybac; Vector Types:; Bacterial Resistance:Ampicillin | 2022-04-22 03:31:08 | 0 | ||
|
AByC Resource Report Resource Website |
RRID:Addgene_164149 | Y-Left-GypSy_3xp3-optimized-tdtomato-Attp-CTCF-Y-Right | Drosophila melanogaster | Ampicillin | PMID:30079589 | Backbone Size:4095; Vector Backbone:piggybac; Vector Types:; Bacterial Resistance:Ampicillin | 2022-04-22 03:31:08 | 0 | ||
|
OA-1043 Resource Report Resource Website |
RRID:Addgene_164586 | U6 and DR | Drosophila melanogaster | Ampicillin | PMID:33616113 | Backbone Size:7350; Vector Backbone:white+attB; Vector Types:Insect Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:31:15 | 0 | ||
|
pUASP Flag Rab32 CA Resource Report Resource Website |
RRID:Addgene_44834 | Rab32 | Drosophila melanogaster | Ampicillin | PMID: | Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin | Q79L (constitutive active) | 2022-04-22 03:41:16 | 0 | |
|
pUASP Flag Rab32 DN Resource Report Resource Website |
RRID:Addgene_44835 | Rab32 | Drosophila melanogaster | Ampicillin | PMID: | Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin | T33N (dominant negative) | 2022-04-22 03:41:16 | 0 | |
|
pUASP dsRed Rab27 WT Resource Report Resource Website |
RRID:Addgene_44832 | Rab27 | Drosophila melanogaster | Ampicillin | PMID:17409086 | Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin | 2022-04-22 03:41:16 | 0 | ||
|
pUASP dsRed Rab11 DN Resource Report Resource Website |
RRID:Addgene_44831 | Rab11 | Drosophila melanogaster | Ampicillin | PMID:17409086 | Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin | S25N (dominant negative) | 2022-04-22 03:41:16 | 0 | |
|
pUASP dsRed Rab11 WT Resource Report Resource Website |
RRID:Addgene_44829 | Rab11 | Drosophila melanogaster | Ampicillin | PMID:17409086 | Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin | 2022-04-22 03:41:16 | 0 | ||
|
pUASP dsRed Rab3 WT Resource Report Resource Website |
RRID:Addgene_44820 | Rab3 | Drosophila melanogaster | Ampicillin | PMID:17409086 | Backbone Size:9939; Vector Backbone:pUASP; Vector Types:Insect Expression, Other, Drosophila; Bacterial Resistance:Ampicillin | 2022-04-22 03:41:16 | 0 | ||
|
psiCheck-2-3 x mir-34 Resource Report Resource Website |
RRID:Addgene_40831 | three sites partially complementary to miR-34 | Drosophila melanogaster | Ampicillin | PMID:22055293 | The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC the triple(3x)-repeated sequence: 5'TGGCAGTGACCTTAGCATCAACAC-3' 3'ACCGTCACTGGAATCGTAGTTGTG-5' pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion. | Backbone Marker:promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin | 2022-04-22 03:40:12 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
