Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pFUSEss-CHIg-mG3_M18 Resource Report Resource Website |
RRID:Addgene_82356 | mouse immunoglobulin heavy chain IgG3 isotype | Mus musculus | Bleocin (Zeocin) | PMID:27484487 | Backbone Marker:Invivogen; Backbone Size:4501; Vector Backbone:pFUSEss-CHIg-mG3; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | none | 2023-03-31 01:08:43 | 0 | |
|
pFUSEss-CHIg-mG1_M18 Resource Report Resource Website |
RRID:Addgene_82357 | mouse immunoglobulin heavy chain IgG1 isotype | Mus musculus | Bleocin (Zeocin) | PMID:27484487 | Backbone Marker:Invivogen; Backbone Size:4492; Vector Backbone:pFUSEss-CHIg-mG1; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | none | 2023-03-31 01:08:43 | 0 | |
|
pFUSEss-chimeric-IgM-mouse/human_M18 Resource Report Resource Website |
RRID:Addgene_91738 | immunoglobulin heavy constant mu | Mus musculus | Bleocin (Zeocin) | PMID:29323348 | Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Residues 203-239 (EU numbering) were exchanged to human homologue sequence. | 2023-03-31 01:09:13 | 0 | |
|
pBoPyV2a-S22 Resource Report Resource Website |
RRID:Addgene_62356 | Full genome of BoPyV2a isolate S22 | Other | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with SacII | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:52 | 0 | |
|
pFUSEss-CHIg-mM-Arg210Ala_M18 Resource Report Resource Website |
RRID:Addgene_91734 | immunoglobulin heavy constant mu | Mus musculus | Bleocin (Zeocin) | PMID:29323348 | Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Arg210 changed to Ala (EU numbering) | 2023-03-31 01:09:13 | 0 | |
|
pFUSEss-CHIg-mM-Asp212Ala_M18 Resource Report Resource Website |
RRID:Addgene_91735 | immunoglobulin heavy constant mu | Mus musculus | Bleocin (Zeocin) | PMID:29323348 | Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Asp212 changed to Ala (EU numbering) | 2023-03-31 01:09:13 | 0 | |
|
pFUSEss-CHIg-mM-Lys208Ala_M18 Resource Report Resource Website |
RRID:Addgene_91732 | immunoglobulin heavy constant mu | Mus musculus | Bleocin (Zeocin) | PMID:29323348 | Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Lys208 changed to Ala (EU numbering) | 2023-03-31 01:09:13 | 0 | |
|
pFUSEss-CHIg-mM-His204Ala_M18 Resource Report Resource Website |
RRID:Addgene_91730 | immunoglobulin heavy constant mu | Mus musculus | Bleocin (Zeocin) | PMID:29323348 | Backbone Marker:Invivogen; Backbone Size:4852; Vector Backbone:pFUSEss-CHIg-mM; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | His204 changed to Ala (EU numbering) | 2023-03-31 01:09:13 | 0 | |
|
pBoPyV3-S22 Resource Report Resource Website |
RRID:Addgene_62368 | Full genome of BoPyV3 isolate S22 | Other | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:52 | 0 | |
|
pBoPyV3-S23 Resource Report Resource Website |
RRID:Addgene_62369 | Full genome of BoPyV3 isolate S23 | Other | Bleocin (Zeocin) | PMID:25568187 | Genome can be liberated by digestion with EcoRI | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:52 | 0 | |
|
pIZ-Flag6His-BmAgo3 Resource Report Resource Website |
RRID:Addgene_50559 | BmAgo3 | Other | Bleocin (Zeocin) | PMID:19460866 | Backbone Marker:Invitrogen; Backbone Size:2900; Vector Backbone:pIZ/V5-His; Vector Types:Insect Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:19 | 0 | ||
|
ph2p Resource Report Resource Website |
RRID:Addgene_22520 | MPyV VP2 | Murine Polyomavirus | Bleocin (Zeocin) | PMID:19750217 | First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm | Backbone Size:3973; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:05:56 | 0 | |
|
SuExp His-Myc-hPLD4 Resource Report Resource Website |
RRID:Addgene_173852 | PLD4 | Homo sapiens | Bleocin (Zeocin) | PMID:34620855 | Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | intracellular and transmembrane domain truncated, with only extracellular domain | 2023-03-31 01:04:35 | 0 | |
|
SuExp His-Myc-hPLD3 Resource Report Resource Website |
RRID:Addgene_173851 | PLD3 | Homo sapiens | Bleocin (Zeocin) | PMID:34620855 | Backbone Marker:Nemazee lab (Deli); Backbone Size:2000; Vector Backbone:SuExp; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | intracellular and transmembrane domain truncated, with only extracellular domain | 2023-03-31 01:04:35 | 0 | |
|
p8RwB Resource Report Resource Website |
RRID:Addgene_48733 | dsRed-Express | Other | Bleocin (Zeocin) | PMID:17603495 | This plasmid is nearly identical to pRwB (http://www.addgene.org/48734), except that it contains a 2kb stuffer region to bring its size closer to the ~8kb native papillomavirus genome. For more information on using this plasmid, please see the following website: http://home.ccr.cancer.gov/Lco/target.htm | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:13 | 0 | |
|
pCAG-p21_S146A Resource Report Resource Website |
RRID:Addgene_40205 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | S146A | 2023-03-31 01:06:45 | 0 | |
|
pCAG-p21_T145A/S146A Resource Report Resource Website |
RRID:Addgene_42623 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | T145A/S146A | 2023-03-31 01:06:52 | 0 | |
|
pwM Resource Report Resource Website |
RRID:Addgene_22515 | MCPyV VP1 | Merkel Cell Polyomavirus | Bleocin (Zeocin) | PMID:19750217 | First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm | Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | codon modified gene | 2023-03-31 01:05:56 | 0 |
|
pMODloxZeo3DAmp Resource Report Resource Website |
RRID:Addgene_27182 | lox-EM7p-Zeo-lox cassette flanked by Tn5 outer element | synthetic | Bleocin (Zeocin) | PMID:15784610 | Note that Bleomycin and Zeocin are the same antibiotic. | Backbone Marker:Epicentre; Backbone Size:2000; Vector Backbone:pMOD |
2023-03-31 01:06:11 | 0 | |
|
M-tdTom-SP Resource Report Resource Website |
RRID:Addgene_48677 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, SP-PAM, and tdTomato reporter. Compatible with S. pyogenes Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:13 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
