Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:gentamicin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

693 Results - per page

Show More Columns | Download 693 Result(s)

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
pDONR207 SARS-CoV-2 NSP1 124A/125A
 
Resource Report
Resource Website
RRID:Addgene_164523 NSP1 124A/125A Other Gentamicin PMID:33080218 Vector Backbone:pDONR207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin Insert of NSP1 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1 with amino acid substitutions R124A/K125A. 2023-04-01 01:04:00 0
pDONR207 SARS-CoV-2 NSP3_nostop
 
Resource Report
Resource Website
RRID:Addgene_149306 NSP3 Other Gentamicin PMID:32763951 Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2023-04-01 01:03:09 0
64 pCOLI_G2
 
Resource Report
Resource Website
RRID:Addgene_160206 Gentamicin PMID:32955754 Vector Backbone:pST50Trc; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin 2023-04-01 01:03:43 0
pDONR207 SARS-CoV-2 ORF3A_nostop
 
Resource Report
Resource Website
RRID:Addgene_149319 ORF3A Other Gentamicin PMID:32763951 Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2023-04-01 01:03:09 0
pBSV2G_Psyn-sgRNAflaB
 
Resource Report
Resource Website
RRID:Addgene_149560 sgRNAflaB Synthetic Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:12 0
pBSV2G_Psyn-sgRNAmreB
 
Resource Report
Resource Website
RRID:Addgene_149566 sgRNAmreB Synthetic Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:12 0
pBSV2G_Psyn-sgRNArodA
 
Resource Report
Resource Website
RRID:Addgene_149568 sgRNArodA Synthetic Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:12 0
pDONR207 SARS-CoV-2 E 27nt-del_nostop
 
Resource Report
Resource Website
RRID:Addgene_153955 E Other Gentamicin PMID:32763951 Kim et al. 2020 can be accessed at https://doi.org/10.1016/j.cell.2020.04.011 Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2023-04-01 01:03:20 0
pDONR207 SARS-CoV2 TEV-NSP3
 
Resource Report
Resource Website
RRID:Addgene_154402 NSP3 Other Gentamicin PMID:32763951 Backbone Marker:Rual et al, Genome Res. 14:2128-2135, 2004.; Backbone Size:5005; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector, with insert of NSP3 CDS with a TEV sequence at the N-term.; Bacterial Resistance:Gentamicin Many synonymous changes due to codon optimization 2023-04-01 01:03:22 0
pBSV2G_PresTL-sgRNA500
 
Resource Report
Resource Website
RRID:Addgene_149617 Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:13 0
pBSV2G_P0826S-sgRNA500
 
Resource Report
Resource Website
RRID:Addgene_149618 Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:13 0
pKAR5
 
Resource Report
Resource Website
RRID:Addgene_149461 AraC-mRFP Synthetic Gentamicin PMID:34125913 Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin 2023-04-01 01:03:11 0
pKCyR5
 
Resource Report
Resource Website
RRID:Addgene_149463 CymR(AM)-mRFP Synthetic Gentamicin PMID:34125913 Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin 2023-04-01 01:03:11 0
pKLlR5
 
Resource Report
Resource Website
RRID:Addgene_149464 LacI-mRFP Synthetic Gentamicin PMID:34125913 Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin 2023-04-01 01:03:11 0
pKLxR5
 
Resource Report
Resource Website
RRID:Addgene_149465 LuxR-mRFP Synthetic Gentamicin PMID:34125913 Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin 2023-04-01 01:03:11 0
pBSV2G_P0526-sgRNA500
 
Resource Report
Resource Website
RRID:Addgene_149621 Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:13 0
pBSV2G_P0826L-sgRNAflaB
 
Resource Report
Resource Website
RRID:Addgene_149627 sgRNAflaB Synthetic Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:14 0
pBSV2G_P0026-sgRNAflaB
 
Resource Report
Resource Website
RRID:Addgene_149628 sgRNAflaB Synthetic Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:14 0
pBSV2G_P0526-sgRNAflaB
 
Resource Report
Resource Website
RRID:Addgene_149629 sgRNAflaB Synthetic Gentamicin PMID:33257311 Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin 2023-04-01 01:03:14 0
pEN_hU6miR-Gb2-K
 
Resource Report
Resource Website
RRID:Addgene_25759 Gb2 miR-shRNA Mus musculus Gentamicin PMID:16945906 Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin 2023-04-01 01:05:42 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.