Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pDONR207 SARS-CoV-2 NSP1 124A/125A Resource Report Resource Website |
RRID:Addgene_164523 | NSP1 124A/125A | Other | Gentamicin | PMID:33080218 | Vector Backbone:pDONR207; Vector Types:Mammalian Expression; Bacterial Resistance:Gentamicin | Insert of NSP1 gene's CDS from SARS-CoV-2 isolate Wuhan-Hu-1 with amino acid substitutions R124A/K125A. | 2023-04-01 01:04:00 | 0 | |
|
pDONR207 SARS-CoV-2 NSP3_nostop Resource Report Resource Website |
RRID:Addgene_149306 | NSP3 | Other | Gentamicin | PMID:32763951 | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin | Many synonymous changes due to codon optimization | 2023-04-01 01:03:09 | 0 | |
|
64 pCOLI_G2 Resource Report Resource Website |
RRID:Addgene_160206 | Gentamicin | PMID:32955754 | Vector Backbone:pST50Trc; Vector Types:Bacterial Expression; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:43 | 0 | ||||
|
pDONR207 SARS-CoV-2 ORF3A_nostop Resource Report Resource Website |
RRID:Addgene_149319 | ORF3A | Other | Gentamicin | PMID:32763951 | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin | Many synonymous changes due to codon optimization | 2023-04-01 01:03:09 | 0 | |
|
pBSV2G_Psyn-sgRNAflaB Resource Report Resource Website |
RRID:Addgene_149560 | sgRNAflaB | Synthetic | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:12 | 0 | ||
|
pBSV2G_Psyn-sgRNAmreB Resource Report Resource Website |
RRID:Addgene_149566 | sgRNAmreB | Synthetic | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:12 | 0 | ||
|
pBSV2G_Psyn-sgRNArodA Resource Report Resource Website |
RRID:Addgene_149568 | sgRNArodA | Synthetic | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:12 | 0 | ||
|
pDONR207 SARS-CoV-2 E 27nt-del_nostop Resource Report Resource Website |
RRID:Addgene_153955 | E | Other | Gentamicin | PMID:32763951 | Kim et al. 2020 can be accessed at https://doi.org/10.1016/j.cell.2020.04.011 | Backbone Marker:Invitrogen; Backbone Size:5585; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector; Bacterial Resistance:Gentamicin | Many synonymous changes due to codon optimization | 2023-04-01 01:03:20 | 0 |
|
pDONR207 SARS-CoV2 TEV-NSP3 Resource Report Resource Website |
RRID:Addgene_154402 | NSP3 | Other | Gentamicin | PMID:32763951 | Backbone Marker:Rual et al, Genome Res. 14:2128-2135, 2004.; Backbone Size:5005; Vector Backbone:pDONR207; Vector Types:Other, Gateway-compatible Entry vector, with insert of NSP3 CDS with a TEV sequence at the N-term.; Bacterial Resistance:Gentamicin | Many synonymous changes due to codon optimization | 2023-04-01 01:03:22 | 0 | |
|
pBSV2G_PresTL-sgRNA500 Resource Report Resource Website |
RRID:Addgene_149617 | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:13 | 0 | ||||
|
pBSV2G_P0826S-sgRNA500 Resource Report Resource Website |
RRID:Addgene_149618 | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:13 | 0 | ||||
|
pKAR5 Resource Report Resource Website |
RRID:Addgene_149461 | AraC-mRFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:11 | 0 | ||
|
pKCyR5 Resource Report Resource Website |
RRID:Addgene_149463 | CymR(AM)-mRFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:11 | 0 | ||
|
pKLlR5 Resource Report Resource Website |
RRID:Addgene_149464 | LacI-mRFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:11 | 0 | ||
|
pKLxR5 Resource Report Resource Website |
RRID:Addgene_149465 | LuxR-mRFP | Synthetic | Gentamicin | PMID:34125913 | Vector Backbone:Unspecified; Vector Types:Bacterial Expression, Synthetic Biology; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:11 | 0 | ||
|
pBSV2G_P0526-sgRNA500 Resource Report Resource Website |
RRID:Addgene_149621 | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:13 | 0 | ||||
|
pBSV2G_P0826L-sgRNAflaB Resource Report Resource Website |
RRID:Addgene_149627 | sgRNAflaB | Synthetic | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:14 | 0 | ||
|
pBSV2G_P0026-sgRNAflaB Resource Report Resource Website |
RRID:Addgene_149628 | sgRNAflaB | Synthetic | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:14 | 0 | ||
|
pBSV2G_P0526-sgRNAflaB Resource Report Resource Website |
RRID:Addgene_149629 | sgRNAflaB | Synthetic | Gentamicin | PMID:33257311 | Backbone Marker:CJW lab; Vector Backbone:pBSV2G_2; Vector Types:Bacterial Expression, CRISPR; Bacterial Resistance:Gentamicin | 2023-04-01 01:03:14 | 0 | ||
|
pEN_hU6miR-Gb2-K Resource Report Resource Website |
RRID:Addgene_25759 | Gb2 miR-shRNA | Mus musculus | Gentamicin | PMID:16945906 | Entry vector with U6-driven G beta 2 miR-shRNA G beta 2 miR-shRNA: TGCTCATGTATTCCCACGACAA | Backbone Marker:ATCC 10326362; Backbone Size:4310; Vector Backbone:pENTR1A-Gent; Vector Types:Other, Entry vector; Bacterial Resistance:Gentamicin | 2023-04-01 01:05:42 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.