Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species:
Genetic Insert: ccdB gene, Chloramphenicol resistance gene
Vector Backbone Description: Vector Backbone:pUC57; Vector Types:Other, Gateway; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_114019 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDEST27; Vector Types:Mammalian Expression, Other, Destination; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint
Proper citation: RRID:Addgene_118371 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDEST27; Vector Types:Mammalian Expression, Other, Destination; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint
Proper citation: RRID:Addgene_118372 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pAPIC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: synthetic LexAGAD size is 2850 bp
For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.
Proper citation: RRID:Addgene_112807 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Edouard Evangelisti, Liron Shenhav; Backbone Size:8431; Vector Backbone:pTORGm34GWF; Vector Types:Other, Oomycete expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_112904 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Edouard Evangelisti, Liron Shenhav; Backbone Size:8692; Vector Backbone:pTORKm34GWC; Vector Types:Other, Oomycete expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/652255v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_112898 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Edouard Evangelisti, Liron Shenhav; Backbone Size:6856; Vector Backbone:pTORKm34GW; Vector Types:Other, Oomycete expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/652255v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_112897 Copy
Species: Mus musculus
Genetic Insert: Foxo1-WT-DBD
Vector Backbone Description: Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms.
Proper citation: RRID:Addgene_17555 Copy
Species: Synthetic
Genetic Insert: REL2N91/ccdB
Vector Backbone Description: Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_188444 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pDEST-P4-P3; Vector Types:Other, Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_188887 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_188701 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites.
Proper citation: RRID:Addgene_186370 Copy
Species: Synthetic
Genetic Insert: Cas9H840A
Vector Backbone Description: Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBS(-); Vector Types:Plant Expression, Other, Prime editing destination vector for transient expression in dicot plant protoplast; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: This vector was modified from pPPED, which is made by Dr. Ning Zhang from Dr. Greg Martin lab.
reference:
1. Targeted genome modifications in soybean with CRISPR/Cas9.
Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA.
BMC Biotechnology. 2015;15:16.
Please visit https://www.biorxiv.org/content/10.1101/2020.07.16.206276v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_162469 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5577; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mScarlet-I tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186383 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5583; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mClover3 tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186389 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5796; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal emiRFP703 tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186386 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5427; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal Snap-tag tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186385 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5598; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mVenus tag at Bgl II/Stu I restriction site
Proper citation: RRID:Addgene_186384 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186392 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin
References:
Comments: Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site
Proper citation: RRID:Addgene_186390 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
