Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pUC-L3L2 Resource Report Resource Website |
RRID:Addgene_114019 | ccdB gene, Chloramphenicol resistance gene | Chloramphenicol and Ampicillin | PMID: | Vector Backbone:pUC57; Vector Types:Other, Gateway; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:18:29 | 0 | |||
|
2Flag-pDEST-N Resource Report Resource Website |
RRID:Addgene_118371 | Chloramphenicol and Ampicillin | PMID:30890647 | Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint | Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDEST27; Vector Types:Mammalian Expression, Other, Destination; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:19:51 | 0 | |||
|
2Flag-pDEST-C Resource Report Resource Website |
RRID:Addgene_118372 | Chloramphenicol and Ampicillin | PMID:30890647 | Please visit https://www.biorxiv.org/content/10.1101/445973v1 for BioRxiv preprint | Backbone Marker:Thermo Fisher Scientific; Vector Backbone:pDEST27; Vector Types:Mammalian Expression, Other, Destination; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:19:51 | 0 | |||
|
pDEST-APIC-LexAGAD Resource Report Resource Website |
RRID:Addgene_112807 | Chloramphenicol and Ampicillin | PMID:28874572 | synthetic LexAGAD size is 2850 bp For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/. | Vector Backbone:pAPIC; Vector Types:Bacterial Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:18:09 | 0 | |||
|
pTORGm43GWF Resource Report Resource Website |
RRID:Addgene_112904 | Chloramphenicol and Ampicillin | PMID:31775609 | Backbone Marker:Edouard Evangelisti, Liron Shenhav; Backbone Size:8431; Vector Backbone:pTORGm34GWF; Vector Types:Other, Oomycete expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:18:10 | 0 | ||||
|
pTORKm43GWC Resource Report Resource Website |
RRID:Addgene_112898 | Chloramphenicol and Ampicillin | PMID:31575765 | Please visit https://www.biorxiv.org/content/10.1101/652255v1 for bioRxiv preprint. | Backbone Marker:Edouard Evangelisti, Liron Shenhav; Backbone Size:8692; Vector Backbone:pTORKm34GWC; Vector Types:Other, Oomycete expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:18:10 | 0 | |||
|
pTORKm43GW Resource Report Resource Website |
RRID:Addgene_112897 | Chloramphenicol and Ampicillin | PMID:31575765 | Please visit https://www.biorxiv.org/content/10.1101/652255v1 for bioRxiv preprint. | Backbone Marker:Edouard Evangelisti, Liron Shenhav; Backbone Size:6856; Vector Backbone:pTORKm34GW; Vector Types:Other, Oomycete expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-04-22 03:18:10 | 0 | |||
|
DBD (N208AH212R) Foxo1-WT pDNR-CMV Resource Report Resource Website |
RRID:Addgene_17555 | Foxo1-WT-DBD | Mus musculus | Chloramphenicol and Ampicillin | PMID:17717603 | This plasmid also contains a E226G mutation--the author has determined that this mutation does not affect the plasmid detrimentally. It also has K219R and L619P polymorphisms. | Backbone Size:5600; Vector Backbone:pDNR-CMV; Vector Types:Mammalian Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | DNA binding-deficientChanged N208A H212R | 2022-08-31 01:02:16 | 0 |
|
pGP4G-REL2N91-ccdB Resource Report Resource Website |
RRID:Addgene_188444 | REL2N91/ccdB | Synthetic | Chloramphenicol and Ampicillin | PMID:32123041 | Vector Backbone:pGP4G; Vector Types:Yeast Expression; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-08-26 01:02:36 | 0 | ||
|
pMLS715 Resource Report Resource Website |
RRID:Addgene_188887 | Chloramphenicol and Ampicillin | PMID:34748534 | Vector Backbone:pDEST-P4-P3; Vector Types:Other, Multisite Gateway [4-3] Destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-09-01 01:02:30 | 0 | ||||
|
pDEST tol2 UbB polyA Resource Report Resource Website |
RRID:Addgene_188701 | Chloramphenicol and Ampicillin | PMID:26445458 | Vector Backbone:pDEST tol2; Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-09-01 01:02:30 | 0 | ||||
|
pDEST-Spe3-RfA Resource Report Resource Website |
RRID:Addgene_186370 | Chloramphenicol and Ampicillin | PMID:17878951 | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. The injection vector pRN3 was modified to give rise to pSPE3 by inserting a new polylinker EcoR1-Stu1-Pme1-EcoRV-Not1 (GAATTCAGGCCTTTGTTTAAACTTAGATATCGCGGCCGC) between the EcoR1 and Not1 sites. | Backbone Marker:PMID: 7720076; Backbone Size:4885; Vector Backbone:injection vector pRN3; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-09-30 01:02:37 | 0 | |||
|
pPPEDs Resource Report Resource Website |
RRID:Addgene_162469 | Cas9H840A | Synthetic | Chloramphenicol and Ampicillin | PMID:34713247 | This vector was modified from pPPED, which is made by Dr. Ning Zhang from Dr. Greg Martin lab. reference: 1. Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnology. 2015;15:16. Please visit https://www.biorxiv.org/content/10.1101/2020.07.16.206276v1 for bioRxiv preprint. | Backbone Marker:Stratagene; Backbone Size:2958; Vector Backbone:pBS(-); Vector Types:Plant Expression, Other, Prime editing destination vector for transient expression in dicot plant protoplast; Bacterial Resistance:Chloramphenicol and Ampicillin | Change histidine 840 to Alanine | 2022-09-28 01:01:56 | 0 |
|
pDEST-Spe4-Kozak-mScarlet-I-RfA Resource Report Resource Website |
RRID:Addgene_186383 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mScarlet-I tag at Bgl II/Stu I restriction site | Backbone Size:5577; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:26 | 0 | |||
|
pDEST-Spe4-RfA-mClover3-stop Resource Report Resource Website |
RRID:Addgene_186389 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mClover3 tag at EcoR V/Avr II restriction site | Backbone Size:5583; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-Spe4-RfA-emiRFP703-stop Resource Report Resource Website |
RRID:Addgene_186386 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal emiRFP703 tag at EcoR V/Avr II restriction site | Backbone Size:5796; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:29 | 0 | |||
|
pDEST-Spe4-Kozak-Snaptag-RfA Resource Report Resource Website |
RRID:Addgene_186385 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal Snap-tag tag at Bgl II/Stu I restriction site | Backbone Size:5427; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-Spe4-Kozak-mVenus-RfA Resource Report Resource Website |
RRID:Addgene_186384 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of N terminal mVenus tag at Bgl II/Stu I restriction site | Backbone Size:5598; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-Spe4-RfA-mNeonGreen-stop Resource Report Resource Website |
RRID:Addgene_186392 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mNeonGreen tag at EcoR V/Avr II restriction site | Backbone Size:5574; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:38:34 | 0 | |||
|
pDEST-Spe4-RfA-mEos4b-stop Resource Report Resource Website |
RRID:Addgene_186390 | Chloramphenicol and Ampicillin | PMID: | Gateway destination vector for mRNA production to overexpress a protein of interest following microinjection into ascidian eggs. Likely to be useful for zebrafish, Xenopus, urchin and cnidarian (Clytia, Nematostella...) overexpression studies as well. Backbone was modified by insertion of C terminal mEos4b tag at EcoR V/Avr II restriction site | Backbone Size:5547; Vector Backbone:pDEST-Spe4-RfA; Vector Types:Other, Gateway destination vector; Bacterial Resistance:Chloramphenicol and Ampicillin | 2022-10-07 04:51:28 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
