Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Preparing word cloud

×

Plasmids are provided by Addgene and DGRC.

Search

Type in a keyword to search

Filter by records added date
See new records

Options


Current Facets and Filters

  • Bacterial Resistance:ampicillin and kanamycin (facet)


Recent searches

Snippet view Table view
Click the to add this resource to a Collection

1,897 Results - per page

Show More Columns | Download Top 1000 Results

Plasmid Name Proper Citation Insert Name Organism Bacterial Resistance Defining Citation Comments Vector Backbone Description Relevant Mutation Record Last Update Mentions Count
LSB-hsa-miR-376a-5p
 
Resource Report
Resource Website
RRID:Addgene_103498 hsa-miR-376a-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:35 0
LSB-hsa-miR-376c-3p
 
Resource Report
Resource Website
RRID:Addgene_103499 hsa-miR-376c-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:35 0
LSB-hsa-miR-3158-5p
 
Resource Report
Resource Website
RRID:Addgene_103429 hsa-miR-3158-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:34 0
LSB-hsa-miR-514a-3p
 
Resource Report
Resource Website
RRID:Addgene_103597 hsa-miR-514a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:36 0
LSB-hsa-miR-514a-5p
 
Resource Report
Resource Website
RRID:Addgene_103598 hsa-miR-514a-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:36 0
LSB-hsa-miR-519a-3p
 
Resource Report
Resource Website
RRID:Addgene_103606 hsa-miR-519a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:37 0
LSB-hsa-miR-4536-5p
 
Resource Report
Resource Website
RRID:Addgene_103541 hsa-miR-4536-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:36 0
LSB-hsa-miR-548h-5p
 
Resource Report
Resource Website
RRID:Addgene_103636 hsa-miR-548h-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:37 0
LSB-hsa-miR-548d-5p
 
Resource Report
Resource Website
RRID:Addgene_103632 hsa-miR-548d-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:37 0
LSB-hsa-miR-6511a-5p
 
Resource Report
Resource Website
RRID:Addgene_103706 hsa-miR-6511a-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:38 0
LSB-hsa-miR-6511a-3p
 
Resource Report
Resource Website
RRID:Addgene_103705 hsa-miR-6511a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:38 0
LSB-hsa-miR-92a-3p
 
Resource Report
Resource Website
RRID:Addgene_103752 hsa-miR-92a-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:38 0
LSB-hsa-miR-9-5p
 
Resource Report
Resource Website
RRID:Addgene_103749 hsa-miR-9-5p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:38 0
LSB-hsa-miR-9-3p
 
Resource Report
Resource Website
RRID:Addgene_103748 hsa-miR-9-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:38 0
LSB-hsa-miR-7-1-3p
 
Resource Report
Resource Website
RRID:Addgene_103722 hsa-miR-7-1-3p target Homo sapiens Ampicillin and Kanamycin PMID:29934631 Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:15:38 0
pCPP6533
 
Resource Report
Resource Website
RRID:Addgene_128734 Ampicillin and Kanamycin PMID:29742421 Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at help@addgene.org or contact our distributors if you have any questions. Vector Backbone:pUC18R6K-mini-Tn7T; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:23:28 0
pCRISPR01-FnCpf1
 
Resource Report
Resource Website
RRID:Addgene_176529 FnCpf1 Synthetic Ampicillin and Kanamycin PMID:33573639 Backbone Marker:Uffe Mortensen (Addgene plasmid # 87844); Vector Backbone:pFC333; Vector Types:CRISPR, Other, Fungal Expression; Bacterial Resistance:Ampicillin and Kanamycin 2022-05-18 01:15:46 0
pMarC9-R6k
 
Resource Report
Resource Website
1+ mentions
RRID:Addgene_89477 pMarC9-R6k Ampicillin and Kanamycin PMID:30962569 BW29427 is an E. coli strain with diaminopimelic acid (DAP) auxotrophy. BW29427 growth requires 300uM DAP even when cultured in LB. Importantly, BW29427 does not grow in the absence of DAP, which simplifies counterselection of this host strain following biparental mating with Vibrio natriegens. Please visit https://www.biorxiv.org/content/early/2016/06/12/058487 for bioRxiv preprint. Backbone Marker:Victor de Lorenzo lab; Vector Backbone:pBAM1; Vector Types:; Bacterial Resistance:Ampicillin and Kanamycin 2022-06-19 01:04:34 1
pBlueKan+cysMPro
 
Resource Report
Resource Website
RRID:Addgene_187879 Ampicillin and Kanamycin PMID:35416085 Backbone Marker:Stratagene (Agilent Tech); Backbone Size:2864; Vector Backbone:pBluescript KS(+); Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin and Kanamycin 2022-08-17 01:02:29 0
PB-U6-DR-SgRNA-DR-EF1a-mCherry-SV40
 
Resource Report
Resource Website
RRID:Addgene_154002 SgRNA expression system Synthetic Ampicillin and Kanamycin PMID:32185621 INSERT: mCherry driven by EF1a promoter. INSERT: DR-SgRNA driven by U6 promoter. Vector Backbone:PB; Vector Types:CRISPR; Bacterial Resistance:Ampicillin and Kanamycin 2022-04-22 03:28:39 0

Can't find your Plasmid?

We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.

If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.

Can't find the RRID you're searching for? X
X
  1. RRID Portal Resources

    Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.

  2. Navigation

    You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.

  3. Logging in and Registering

    If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.

  4. Searching

    Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:

    1. Use quotes around phrases you want to match exactly
    2. You can manually AND and OR terms to change how we search between words
    3. You can add "-" to terms to make sure no results return with that term in them (ex. Cerebellum -CA1)
    4. You can add "+" to terms to require they be in the data
    5. Using autocomplete specifies which branch of our semantics you with to search and can help refine your search
  5. Collections

    If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.

  6. Facets

    Here are the facets that you can filter the data by.

  7. Further Questions

    If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.