Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: crCD81-1
Vector Backbone Description: Vector Backbone:pRG212; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217344 Copy
Species: Homo sapiens
Genetic Insert: crCD55-4 gRNA: actggtattgcggagccacgagg
Vector Backbone Description: Vector Backbone:pCH49; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217341 Copy
Species:
Genetic Insert:
Vector Backbone Description: Vector Backbone:CROPseq-Guide-BSD (#216123); Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_216134 Copy
Species: Synthetic
Genetic Insert: vGAT-Vh-hIgG1-CH1
Vector Backbone Description: Vector Backbone:gWiz; Vector Types:Mammalian Expression, Affinity Reagent/ Antibody; Bacterial Resistance:Kanamycin
References:
Comments: Sequence derived from NeruoMab Clone #: L118/80 - NeuroMab Seq is supported by grant NIH U24 NS109113.
Proper citation: RRID:Addgene_218436 Copy
Species: Homo sapiens
Genetic Insert: crCD55-4 gRNA: actggtattgcggagccacgagg
Vector Backbone Description: Vector Backbone:pCH67; Vector Types:Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: Please visit https://doi.org/10.1101/2023.09.18.558350 for bioRxiv preprint.
Proper citation: RRID:Addgene_217345 Copy
Species:
Genetic Insert: (mito).cpSFGFP.HaloTag
Vector Backbone Description: Vector Backbone:pAAV.CAG; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin
References:
Comments: Please see bioRxiv preprint at https://doi.org/10.1101/2023.08.24.554624
Proper citation: RRID:Addgene_214925 Copy
Species: Synthetic
Genetic Insert: hU6-crB2M-EFS-PuroR-WPRE
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments:
Proper citation: RRID:Addgene_214881 Copy
Species: Synthetic
Genetic Insert: hU6-crGLY-EFS-PuroR-WPRE
Vector Backbone Description: Vector Backbone:pHR; Vector Types:Mammalian Expression, Lentiviral, CRISPR; Bacterial Resistance:Ampicillin
References:
Comments: RfxCas13d guide array targeting HK1, HK2, AKT1, AKT2
Proper citation: RRID:Addgene_214884 Copy
Species: Other
Genetic Insert: Start; u(S)ORF_v1.1; Stop; Start
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215987 Copy
Species: Other
Genetic Insert: Start; p300_v1.2; Linker_v3.1; SV40NLS_v1.6
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215981 Copy
Species: Other
Genetic Insert: Start
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215983 Copy
Species: Other
Genetic Insert: D4H promoter and 5'UTR
Vector Backbone Description: Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_203894 Copy
Species: Other
Genetic Insert: DAT promoter and 5'UTR
Vector Backbone Description: Backbone Marker:Weber et al., 2011 (DOI:10.1371/journal.pone.0016765); Vector Backbone:pICH41295; Vector Types:Plant Expression; Bacterial Resistance:Spectinomycin
References:
Comments:
Proper citation: RRID:Addgene_203895 Copy
Species: Other
Genetic Insert: Start; mTagBFP2_v1.1
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215997 Copy
Species: Other
Genetic Insert: Start; NeoR_v1.1
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215999 Copy
Species: Other
Genetic Insert: Start; Thy1.1_v1.1; Stop
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215998 Copy
Species: Other
Genetic Insert: Start; V5_v1.1; HaloTag_v1.1
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215991 Copy
Species: Other
Genetic Insert: Start; HygroR_v2.1
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215993 Copy
Species: Other
Genetic Insert: Start; BlastR_v1.1
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215995 Copy
Species: Other
Genetic Insert: U6_v1; DR_v0 [EnAs]; BsmBI_v2; BsmBI_v3
Vector Backbone Description: Vector Backbone:pUC57-Kan; Vector Types:CRISPR, Other, Fragment; Bacterial Resistance:Kanamycin
References:
Comments: Please visit https://www.biorxiv.org/content/10.1101/2023.10.25.564061v1 for bioRxiv preprint.
Proper citation: RRID:Addgene_215927 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.