Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pAAV-CMV-FLEX-TVAmCherry-2A-oG Resource Report Resource Website 1+ mentions |
RRID:Addgene_102985 | TVA-mCherry fusion protein after CRE-mediated recombination | Ampicillin | PMID:28689641 | Vector Backbone:pAAV; Vector Types:AAV, Other, Adeno Associated Viral Vector; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 1 | |||
|
TAL-L1-2.4-VP64 Resource Report Resource Website |
RRID:Addgene_103039 | TAL-L1-2.4-VP64 | Other | Ampicillin | PMID:28846101 | Vector Backbone:pRN3p; Vector Types:Other, T3 in vitro transcription for expression in mammalian cells; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:24 | 0 | ||
|
pCAGGS_VP35_EBOV Resource Report Resource Website |
RRID:Addgene_103050 | VP35 gene of Ebola virus | Other | Ampicillin | PMID:28807685 | Vector Backbone:pCAGGs; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:24 | 0 | ||
|
STAgR_Neo Resource Report Resource Website 1+ mentions |
RRID:Addgene_102992 | Ampicillin | PMID:29702666 | Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, Other, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 1 | ||||
|
pET22B_SA_PcrA Resource Report Resource Website |
RRID:Addgene_102999 | SA_PcrA | Other | Ampicillin | PMID: | Vector Backbone:pET22B; Vector Types:Bacterial Expression; Bacterial Resistance:Ampicillin | PcrA 199-2423 | 2022-04-22 03:15:24 | 0 | |
|
STAgR_tdTomato Resource Report Resource Website |
RRID:Addgene_102993 | Ampicillin | PMID:29702666 | Backbone Marker:Stricker Lab; Vector Backbone:Human gRNA Expression Vector / PCR Template for STAgR; Vector Types:CRISPR, Other, PCR Template for STAgR Vectors; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 0 | ||||
|
pAAV-synp-F-H2B-GCaMP6f Resource Report Resource Website |
RRID:Addgene_102994 | H2B-GCaMP6f | Homo sapiens | Ampicillin | PMID:29736000 | Backbone Marker:unknown; Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 0 | ||
|
pAAV-synp-F-synaptophysin-GCaMP6f Resource Report Resource Website |
RRID:Addgene_102996 | Synaptophysin-GCaMP6f | Homo sapiens | Ampicillin | PMID: | Vector Backbone:pAAV; Vector Types:Mammalian Expression, AAV; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:23 | 0 | ||
|
L-HBsAg Resource Report Resource Website |
RRID:Addgene_103011 | HBV Large envelope protein | Other | Ampicillin | PMID:20657822 | Backbone Marker:Invitrogen; Vector Backbone:pcDNA3; Vector Types:Mammalian Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:24 | 0 | ||
|
pHES609 [prNOp7-PBAC] Resource Report Resource Website |
RRID:Addgene_103017 | bPAC | Saccharomyces cerevisiae | Ampicillin | PMID:28035051 | Vector Backbone:pNH605; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:24 | 0 | ||
|
LSB-hsa-miR-125b-5p Resource Report Resource Website |
RRID:Addgene_103191 | hsa-miR-125b-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-let-7f-5p Resource Report Resource Website |
RRID:Addgene_103156 | hsa-let-7f-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-miR-101-3p Resource Report Resource Website |
RRID:Addgene_103165 | hsa-miR-101-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
LSB-hsa-miR-105-3p Resource Report Resource Website |
RRID:Addgene_103169 | hsa-miR-105-3p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
p413_Csy4NLS Resource Report Resource Website |
RRID:Addgene_103139 | Csy4 | Saccharomyces cerevisiae | Ampicillin | PMID:29161506 | Backbone Marker:ATCC; Backbone Size:5522; Vector Backbone:p413 TEF; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:26 | 0 | ||
|
LSB-hsa-let-7a-5p Resource Report Resource Website |
RRID:Addgene_103146 | hsa-let-7a-5p target | Homo sapiens | Ampicillin and Kanamycin | PMID:29934631 | Please note that this plasmid is inherently unstable due to a repeating poly A element. We recommend performing a diagnostic digest on multiple colonies upon receipt. The depositors would like to note the presence of several discrepancies between the depositor sequence and physical plasmid sequence. In particular, the sequences upstream and downstream of the puromycin coding region have 10 bp insertions which do not affect the ability to perform puromycin selection. The sequences for those regions within the physical plasmids are as follows: Upstream of Puro: GAATTCGACCGCCTGTCTCAAGGTGCCACC; Downstream of Puro: GCTTTGAGACTACGCGTGAATTCACTCCTC. | Vector Backbone:Low Sensor Backbone (LSB); Vector Types:Mammalian Expression, Synthetic Biology; Bacterial Resistance:Ampicillin and Kanamycin | 2022-04-22 03:15:27 | 0 | |
|
dCas9v2 Resource Report Resource Website |
RRID:Addgene_103140 | dCas9-VPR | Saccharomyces cerevisiae | Ampicillin | PMID:29161506 | Vector Backbone:pDTU-113; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | Removed scaffold gRNA from original plasmid | 2022-04-22 03:15:26 | 0 | |
|
pCRA03 Resource Report Resource Website |
RRID:Addgene_103141 | gRNAs | Saccharomyces cerevisiae | Ampicillin | PMID:29161506 | Vector Backbone:dCas9v2; Vector Types:Yeast Expression; Bacterial Resistance:Ampicillin | 2022-04-22 03:15:26 | 0 | ||
|
YCe2986 HC_Kan_conn_H-J Resource Report Resource Website |
RRID:Addgene_100647 | EMMA toolkit Assembly connector H-J | Synthetic | Kanamycin | PMID:28418644 | DNA element with no function. It is used as a bridge to connect parts placed in position 7 and 10 of EMMA platform. | Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2022-04-22 03:14:54 | 0 | |
|
YCe3735 HC_Kan_conn_Ha-K Resource Report Resource Website |
RRID:Addgene_100649 | EMMA toolkit Assembly connector Ha-K | Synthetic | Kanamycin | PMID:28418644 | DNA element with no function. It is used as a bridge to connect parts placed in position 8a and 11 of EMMA platform. | Vector Backbone:pSMART HC_Kan; Vector Types:Synthetic Biology; Bacterial Resistance:Kanamycin | 2022-04-22 03:14:54 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
