Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
Species: Homo sapiens
Genetic Insert: DJ1
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_29410 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_40206 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_40204 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_40203 Copy
Species: Homo sapiens
Genetic Insert: p21
Vector Backbone Description: Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_40202 Copy
Species: Merkel Cell Polyomavirus
Genetic Insert: MCPyV VP2
Vector Backbone Description: Backbone Size:3975; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: First reference to this plasmid was in:
Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6
Genbank style annotated sequences can be found at:
http://home.ccr.cancer.gov/LCO/packaging.htm
Proper citation: RRID:Addgene_22518 Copy
Species: Murine Polyomavirus
Genetic Insert: MPyV VP1
Vector Backbone Description: Backbone Size:5339; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: First reference to this plasmid was in:
Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6
GenBank style annotations can be found at:
http://home.ccr.cancer.gov/LCO/packaging.htm
Proper citation: RRID:Addgene_22519 Copy
Species: Homo sapiens
Genetic Insert: HPV16L1+L2
Vector Backbone Description: Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_45291 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Size:3905; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_31289 Copy
Species: virus
Genetic Insert: MCV Large T antigen
Vector Backbone Description: Backbone Marker:InvivoGen; Backbone Size:3429; Vector Backbone:pMONO-zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information.
Proper citation: RRID:Addgene_32097 Copy
Species: virus
Genetic Insert: BKV VP1
Vector Backbone Description: Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information.
Proper citation: RRID:Addgene_32094 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_48678 Copy
Species: Synthetic
Genetic Insert: TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9
Vector Backbone Description: Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_48679 Copy
Species: Homo sapiens
Genetic Insert: TARG1
Vector Backbone Description: Vector Backbone:pDONRzeo; Vector Types:Other, Gateway cloning; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_172574 Copy
Species: Homo sapiens
Genetic Insert: MACROD2
Vector Backbone Description: Vector Backbone:pDONRzeo; Vector Types:Other, Gateway cloning; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_172573 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Christopher Buck lab; Backbone Size:1851; Vector Backbone:N/A; Vector Types:Other, Cloning vector; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: MCS protected by bacterial transcription terminators.
Proper citation: RRID:Addgene_24754 Copy
Species: polyomavirus
Genetic Insert: VP1 from Human Polyomavirus 6
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 22517; Backbone Size:5339; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_24725 Copy
Species: polyomavirus
Genetic Insert: Full genome of Human polyomavirus 6
Vector Backbone Description: Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments: genome can be liberated by digestion with Hind III.
Proper citation: RRID:Addgene_24727 Copy
Species:
Genetic Insert:
Vector Backbone Description: Backbone Marker:Glickman Lab; Backbone Size:3267; Vector Backbone:pmsg360; Vector Types:Bacterial Expression, Other, mycobacterial ko vector; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_27154 Copy
Species: Mus musculus
Genetic Insert: Eif2s2
Vector Backbone Description: Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin)
References:
Comments:
Proper citation: RRID:Addgene_45898 Copy
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
You can save any searches you perform for quick access to later from here.
We recognized your search term and included synonyms and inferred terms along side your term to help get the data you are looking for.
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the sources that were queried against in your search that you can investigate further.
Here are the categories present within RRID that you can filter your data on
Here are the subcategories present within this category that you can filter your data on
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
