Searching the RRID Resource Information Network
Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
| Plasmid Name | Proper Citation | Insert Name | Organism | Bacterial Resistance | Defining Citation |
Comments |
||||
|---|---|---|---|---|---|---|---|---|---|---|
|
pcDNA3.1/GS-DJ1-C53A Resource Report Resource Website |
RRID:Addgene_29410 | DJ1 | Homo sapiens | Bleocin (Zeocin) | PMID: | Backbone Marker:Invitrogen; Backbone Size:4000; Vector Backbone:pcDNA3.1/GS; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | Cys53Ala | 2023-03-31 01:06:17 | 0 | |
|
pCAG-p21_S146D Resource Report Resource Website |
RRID:Addgene_40206 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | S146D | 2023-03-31 01:06:45 | 0 | |
|
pCAG-p21_T145D Resource Report Resource Website |
RRID:Addgene_40204 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | T145D | 2023-03-31 01:06:45 | 0 | |
|
pCAG-p21_T145A Resource Report Resource Website |
RRID:Addgene_40203 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | T145A | 2023-03-31 01:06:45 | 0 | |
|
pCAG-p21_WT Resource Report Resource Website |
RRID:Addgene_40202 | p21 | Homo sapiens | Bleocin (Zeocin) | PMID:23299246 | Backbone Marker:Invivogen; Vector Backbone:pCAG; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | WT | 2023-03-31 01:06:45 | 0 | |
|
ph2m Resource Report Resource Website |
RRID:Addgene_22518 | MCPyV VP2 | Merkel Cell Polyomavirus | Bleocin (Zeocin) | PMID:19750217 | First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 Genbank style annotated sequences can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm | Backbone Size:3975; Vector Backbone:phGf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | codon modified | 2023-03-31 01:05:56 | 0 |
|
pwP Resource Report Resource Website |
RRID:Addgene_22519 | MPyV VP1 | Murine Polyomavirus | Bleocin (Zeocin) | PMID:19750217 | First reference to this plasmid was in: Human Merkel cell polyomavirus infection II. MCV is a common human infection that can be detected by conformational capsid epitope immunoassays. Tolstov YL, Pastrana DV, Feng H, Becker JC, Jenkins FJ, Moschos S, Chang Y, Buck CB, Moore PS. Int J Cancer. 2009 Sep 15.125(6):1250-6 GenBank style annotations can be found at: http://home.ccr.cancer.gov/LCO/packaging.htm | Backbone Size:5339; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | codon modified | 2023-03-31 01:05:56 | 0 |
|
p16L1L2 Resource Report Resource Website |
RRID:Addgene_45291 | HPV16L1+L2 | Homo sapiens | Bleocin (Zeocin) | PMID:18228512 | Vector Backbone:custom; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:02 | 0 | ||
|
pGMCZq17-OXOX Resource Report Resource Website |
RRID:Addgene_31289 | Bleocin (Zeocin) | PMID:21238944 | Backbone Size:3905; Vector Backbone:N/A; Vector Types:Bacterial Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:06:21 | 0 | ||||
|
pADL* Resource Report Resource Website |
RRID:Addgene_32097 | MCV Large T antigen | virus | Bleocin (Zeocin) | PMID:21829355 | Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information. | Backbone Marker:InvivoGen; Backbone Size:3429; Vector Backbone:pMONO-zeo; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 57kT splice sites silently mutated, P156S to match consensus | 2023-03-31 01:06:23 | 0 |
|
pwB2b Resource Report Resource Website |
RRID:Addgene_32094 | BKV VP1 | virus | Bleocin (Zeocin) | PMID:21829355 | Please consult laboratory website, http://home.ccr.cancer.gov/Lco/plasmids.asp, for more information. | Backbone Size:5338; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | codon modified | 2023-03-31 01:06:23 | 0 |
|
M-tdTom-ST1 Resource Report Resource Website |
RRID:Addgene_48678 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, ST1-PAM, and tdTomato reporter. Compatible with S. thermophilus #1 Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:13 | 0 | ||
|
M-tdTom-NM Resource Report Resource Website |
RRID:Addgene_48679 | TAL binding site w/ GTCCCCTCCACCCCACAGTG protospacer, NM-PAM, and tdTomato reporter. Compatible with N. meningitidis Cas9 | Synthetic | Bleocin (Zeocin) | PMID:24076762 | Vector Backbone:Unknown; Vector Types:CRISPR; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:13 | 0 | ||
|
pDONR/zeo-TARG1 Resource Report Resource Website |
RRID:Addgene_172574 | TARG1 | Homo sapiens | Bleocin (Zeocin) | PMID:32427867 | Vector Backbone:pDONRzeo; Vector Types:Other, Gateway cloning; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:04:30 | 0 | ||
|
pDONR/zeo-MACROD2 Resource Report Resource Website |
RRID:Addgene_172573 | MACROD2 | Homo sapiens | Bleocin (Zeocin) | PMID:32427867 | Vector Backbone:pDONRzeo; Vector Types:Other, Gateway cloning; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:04:30 | 0 | ||
|
pAsylum Resource Report Resource Website |
RRID:Addgene_24754 | Bleocin (Zeocin) | PMID:20542254 | MCS protected by bacterial transcription terminators. | Backbone Marker:Christopher Buck lab; Backbone Size:1851; Vector Backbone:N/A; Vector Types:Other, Cloning vector; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:06:03 | 0 | |||
|
p6VP1 Resource Report Resource Website |
RRID:Addgene_24725 | VP1 from Human Polyomavirus 6 | polyomavirus | Bleocin (Zeocin) | PMID:20542254 | Backbone Marker:Christopher Buck lab, Addgene plasmid 22517; Backbone Size:5339; Vector Backbone:pGwf; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:06:03 | 0 | ||
|
pHPyV6-607a Resource Report Resource Website |
RRID:Addgene_24727 | Full genome of Human polyomavirus 6 | polyomavirus | Bleocin (Zeocin) | PMID:20542254 | genome can be liberated by digestion with Hind III. | Backbone Marker:Christopher Buck lab, Addgene plasmid 24755; Backbone Size:2131; Vector Backbone:pFunnyfarm; Vector Types:Other, Viral clone; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:06:03 | 0 | |
|
pMSG360zeo Resource Report Resource Website |
RRID:Addgene_27154 | Bleocin (Zeocin) | PMID:20472794 | Backbone Marker:Glickman Lab; Backbone Size:3267; Vector Backbone:pmsg360; Vector Types:Bacterial Expression, Other, mycobacterial ko vector; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:06:11 | 0 | ||||
|
pSV HA eIF2beta WT Resource Report Resource Website |
RRID:Addgene_45898 | Eif2s2 | Mus musculus | Bleocin (Zeocin) | PMID:11959995 | Backbone Marker:Invitrogen; Backbone Size:3500; Vector Backbone:pZeoSV2; Vector Types:Mammalian Expression; Bacterial Resistance:Bleocin (Zeocin) | 2023-03-31 01:07:03 | 0 |
Can't find your Plasmid?
We recommend that you click next to the search bar to check some helpful tips on searches and refine your search firstly. If you want to find a specific plasmid, it's easier to enter an RRID or an Addgene Catalog Number to search. You can refine the search results using Facets on the left side of the search results page. If you are on the table view, you can also search in a specific column by clicking the column title and enter the keywords.
If you still could not find your plasmid in the search results, please help us by registering it into the system — it's easy. Register it with Addgene.
Welcome to the RRID Resources search. From here you can search through a compilation of resources used by RRID and see how data is organized within our community.
You are currently on the Community Resources tab looking through categories and sources that RRID has compiled. You can navigate through those categories from here or change to a different tab to execute your search through. Each tab gives a different perspective on data.
If you have an account on RRID then you can log in from here to get additional features in RRID such as Collections, Saved Searches, and managing Resources.
Here is the search term that is being executed, you can type in anything you want to search for. Some tips to help searching:
If you are logged into RRID you can add data records to your collections to create custom spreadsheets across multiple sources of data.
Here are the facets that you can filter the data by.
If you have any further questions please check out our FAQs Page to ask questions and see our tutorials. Click this button to view this tutorial again.
