Searching the RRID Resource Information Network

Our searching services are busy right now. Please try again later

  • Register
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

X

Leaving Community

Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.

No
Yes
X
Forgot Password

If you have forgotten your password you can enter your email here and get a temporary password sent to your email.

Organism Name
PS8008
RRID:WB-STRAIN:WBStrain00031052 RRID Copied  
PDF Report How to cite
RRID:WB-STRAIN:WBStrain00031052
Copy Citation Copied
Organism Information

URL: http://www.wormbase.org/db/get?name=WBStrain00031052

Proper Citation: RRID:WB-STRAIN:WBStrain00031052

Description: Caenorhabditis elegans with name ZC376.2(sy1170) V. from WB.

Species: Caenorhabditis elegans

Synonyms: ZC376.2(sy1170) V.

Notes: Made_by: Heenam Park|"STOP-IN Cassette (;43 bp universal insertion fragment with 3-frame stop codon for knock-out) GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc"|"Superficially wild-type. CRISPR/Cas9 engineered STOP-IN null mutant of ZC376.2; Universal 43bp-long knock-in insertion with 3-frame stop codon (STOP-IN cassette). Left flanking sequence: CCCTGGGACGGAGTTTTGGAGGCGAAGGAGTATA Right flanking sequence: AAGCGGCTTGTATGAGTGATCAGAAgtaagagata inserted sequence between the two flanking sequence (STOP-In casette): GGGAAGTTTGTCCAGAGCAGAGGTGACTAAGTGATAAgctagc. sgRNA : GGAGGCGAAGGAGTATAAAG Method Reference: G3 (Bethesda). 2018 Nov 6;8(11):3607-3616"

Affected Gene: WBGene00013874(cest-2.2)

Expand All
Usage and Citation Metrics

We found {{ ctrl2.mentions.all_count }} mentions in open access literature.

We have not found any literature mentions for this resource.

We are searching literature mentions for this resource.

Most recent articles:

{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})

Checkfor all resource mentions.

Collaborator Network

A list of researchers who have used the resource and an author search tool

Find mentions based on location


{{ ctrl2.mentions.errors.location }}

A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.

Ratings and Alerts

No rating or validation information has been found for PS8008.

No alerts have been found for PS8008.

Data and Source Information

Source: Integrated Animals

Source Database: WormBase (WB)