Are you sure you want to leave this community? Leaving the community will revoke any permissions you have been granted in this community.
URL: http://www.addgene.org/40831
Proper Citation: RRID:Addgene_40831
Insert Name: three sites partially complementary to miR-34
Organism: Drosophila melanogaster
Bacterial Resistance: Ampicillin
Defining Citation: PMID:22055293
Vector Backbone Description: Backbone Marker:promega; Backbone Size:6273; Vector Backbone:psiCheck-2; Vector Types:Insect Expression, RNAi; Bacterial Resistance:Ampicillin
Comments: The psiCheck-3xmiR-34 sequences were cloned by synthesized dsDNA S: 5'-TCGAGGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGTGTTGATGCTAAGGTCACTGCCAGC AS: 5'-GGCCGCTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACTGGCAGTGACCTTAGCATCAACACC the triple(3x)-repeated sequence: 5'TGGCAGTGACCTTAGCATCAACAC-3' 3'ACCGTCACTGGAATCGTAGTTGTG-5' pairs with dme-miR-34 (uggcagugugguuagcugguugug) with "seed(red) plus 3' complementary region (blue)" fashion.
Expand AllWe found {{ ctrl2.mentions.all_count }} mentions in open access literature.
We have not found any literature mentions for this resource.
We are searching literature mentions for this resource.
Most recent articles:
{{ mention._source.dc.creators[0].familyName }} {{ mention._source.dc.creators[0].initials }}, et al. ({{ mention._source.dc.publicationYear }}) {{ mention._source.dc.title }} {{ mention._source.dc.publishers[0].name }}, {{ mention._source.dc.publishers[0].volume }}({{ mention._source.dc.publishers[0].issue }}), {{ mention._source.dc.publishers[0].pagination }}. (PMID:{{ mention._id.replace('PMID:', '') }})
A list of researchers who have used the resource and an author search tool
A list of researchers who have used the resource and an author search tool. This is available for resources that have literature mentions.
No rating or validation information has been found for psiCheck-2-3 x mir-34.
No alerts have been found for psiCheck-2-3 x mir-34.
Source: Addgene